PCR detection kit for rapidly identifying Salmonella Pullorum/Salmonella Gullinarum

A technology of Salmonella typhimurium and detection kit, which is applied in the field of biotechnology detection, can solve the problems of cumbersome process, laboriousness, false positive and unsuitable for routine detection, etc., and achieves the effect of good repeatability

Active Publication Date: 2018-07-27
YANGZHOU UNIV
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The process is cumbersome, laborious, and time-consuming, and it takes 4-7 days to complete. Compared with other identi...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • PCR detection kit for rapidly identifying Salmonella Pullorum/Salmonella Gullinarum
  • PCR detection kit for rapidly identifying Salmonella Pullorum/Salmonella Gullinarum
  • PCR detection kit for rapidly identifying Salmonella Pullorum/Salmonella Gullinarum

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1 Bioinformatics method to identify the distribution of the SPUL_2693 gene

[0038] In NCBI, use the Blastn online comparison software (http: / / blast.ncbi.nlm.nih.gov / Blast.cgi) to search for the SPUL_2693 gene in the genome-wide database, and the search results show that all pullorum / Salmonella gallinarum contain SPUL_2693 gene, and the nucleotide sequence of the gene length is 2160bp, except for some rare serotypes (non-avian Salmonella), other serotypes of Salmonella have no gene SPUL_2693, and SPUL_2693 has good specificity ( figure 1 ).

[0039] The nucleotide sequence of pullorum / salmonella gallinarum typhi SPUL_2693 is shown in SEQ ID NO.3, specifically:

[0040] ATGGATAAGCGTCATGAGAAATTGCGAATACCTTACAGAAAAGAGGGAGAGTCTTTAGACTATGAATCAGATGCAAAAGTTGAGGCATTACAAGAAATAAACGGTGAACTGATTCGTGTAGGGAATGTTGATATAAGAGAGACTACCCAATCTACTCTCGTACTTGAAAATCCAAAGATTCGCATTCAGACTAATATTGGCGACACTTTGAAATTACGAAGTCAACAAGATCTATCATCTTTTATTCGTAGGCGTCATGCAGTTACACGTATTTTAAATGCTGAATCGGCTATCCCC...

Embodiment 2

[0041] The preparation of embodiment 2 kit

[0042] Primer design and synthesis: Using the SPUL_2693 gene as a template, design and analyze primers, and select the best detection primer pair according to the genomic DNA sequence. The nucleotide sequences are shown in Table 1 below:

[0043] Table 1

[0044]

[0045] The above-mentioned primer pairs can be packaged individually, or can be made into a PCR detection solution. In the PCR detection solution, the amount of the above-mentioned primer pairs can be the conventional amount known to those skilled in the art.

[0046] That is to say, the kit of the present invention may contain the aforementioned independently packaged primer pair, or may contain a configured PCR detection solution containing the primer pair.

[0047] Further, the kit can also contain double distilled water (ddH 2 O), 2×Taq Master Mix, sample genomic DNA extraction reagents, etc.

Embodiment 3

[0048] Example 3 Specific identification of the kit for detecting pullorum / Salmonella gallinarum typhi

[0049] Using the primers in the kit described in Example 2, using the genomes of different serotypes of Salmonella and other bacteria as templates, the distribution characteristics of the SPUL_2693 gene in different bacteria were identified by PCR.

[0050] The PCR reaction system is (25 μL): 9.5 μL double distilled water (ddH 2 O), 12.5 μL 2×Taq Master Mix, SPUL_2693-F 1 μL, SPUL_2693-R 1 μL, template 1 μL.

[0051] The PCR program is (a) 94°C for 5min; (b) 94°C for 45s; (c) 65°C for 30s; (d) 72°C for 2min16s, steps (b) to (d) cycled 25 times; (e) 72°C for 10min.

[0052] PCR products can be stored at 4°C.

[0053] PCR product carries out 1% agarose gel electrophoresis, and PCR electrophoresis result shows that all have 2160bp object band ( figure 2 , Figure 4 ), while other serotypes of Salmonella did not amplify the bands ( figure 2 , image 3 , Figure 4 ), sh...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the field of biotechnology detection, and particularly relates to a PCR detection kit for rapidly identifying Salmonella Pullorum/Salmonella Gullinarum, wherein the PCR detection kit comprises a SPUL_2693 gene detection primer pair, and the SPUL_2693 gene detection primer pair comprises a forward primer with a nucleotide sequence represented by SEQ ID NO.1 and a reverse primer with a nucleotide sequence represented by SEQ ID NO.2. According to the present invention, the kit can perform rapid and high-throughput identification on Salmonella Pullorum/Salmonella Gullinarum, can be used as the auxiliary method for the traditional serological typing of Salmonella, and provides the new simple, rapid and highly-sensitive method for the monitoring and laboratory diagnosisof Salmonella Pullorum/Salmonella Gullinarum.

Description

technical field [0001] The invention belongs to the field of biotechnology detection, in particular to a PCR detection kit for rapidly identifying pullorum / salmonella gallinarum typhi. Background technique [0002] Salmonellosis is one of the important infectious diseases in public health. The pathogen Salmonella belongs to Enterobacteriaceae. Eggs, livestock and meat products are the main media, which can cause a variety of livestock and poultry diseases, resulting in systemic sepsis and enteritis. Pullorum pullorum and typhoid fever are caused by Salmonella Pullorum and Salmonella Gallinarum respectively. Salmonella pullorum, also known as Salmonella pullorum, can cause pullorum disease in poultry, and it mostly affects young chicks within 3 weeks of age, with high morbidity and mortality; it can also cause pullorum disease in older young chickens. Adult chickens can also be infected, which often leads to decreased egg production, deformity of the reproductive tract, and...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/68C12Q1/10
CPCC12Q1/689C12Q2600/166Y02A50/30
Inventor 焦新安潘志明许莹胡亚辰郭亚鑫孟闯耿士忠黄金林李求春孙林
Owner YANGZHOU UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap