PCR detection kit for rapidly identifying Salmonella Pullorum/Salmonella Gullinarum
A technology of Salmonella typhimurium and detection kit, which is applied in the field of biotechnology detection, can solve the problems of cumbersome process, laboriousness, false positive and unsuitable for routine detection, etc., and achieves the effect of good repeatability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Example 1 Bioinformatics method to identify the distribution of the SPUL_2693 gene
[0038] In NCBI, use the Blastn online comparison software (http: / / blast.ncbi.nlm.nih.gov / Blast.cgi) to search for the SPUL_2693 gene in the genome-wide database, and the search results show that all pullorum / Salmonella gallinarum contain SPUL_2693 gene, and the nucleotide sequence of the gene length is 2160bp, except for some rare serotypes (non-avian Salmonella), other serotypes of Salmonella have no gene SPUL_2693, and SPUL_2693 has good specificity ( figure 1 ).
[0039] The nucleotide sequence of pullorum / salmonella gallinarum typhi SPUL_2693 is shown in SEQ ID NO.3, specifically:
[0040] ATGGATAAGCGTCATGAGAAATTGCGAATACCTTACAGAAAAGAGGGAGAGTCTTTAGACTATGAATCAGATGCAAAAGTTGAGGCATTACAAGAAATAAACGGTGAACTGATTCGTGTAGGGAATGTTGATATAAGAGAGACTACCCAATCTACTCTCGTACTTGAAAATCCAAAGATTCGCATTCAGACTAATATTGGCGACACTTTGAAATTACGAAGTCAACAAGATCTATCATCTTTTATTCGTAGGCGTCATGCAGTTACACGTATTTTAAATGCTGAATCGGCTATCCCC...
Embodiment 2
[0041] The preparation of embodiment 2 kit
[0042] Primer design and synthesis: Using the SPUL_2693 gene as a template, design and analyze primers, and select the best detection primer pair according to the genomic DNA sequence. The nucleotide sequences are shown in Table 1 below:
[0043] Table 1
[0044]
[0045] The above-mentioned primer pairs can be packaged individually, or can be made into a PCR detection solution. In the PCR detection solution, the amount of the above-mentioned primer pairs can be the conventional amount known to those skilled in the art.
[0046] That is to say, the kit of the present invention may contain the aforementioned independently packaged primer pair, or may contain a configured PCR detection solution containing the primer pair.
[0047] Further, the kit can also contain double distilled water (ddH 2 O), 2×Taq Master Mix, sample genomic DNA extraction reagents, etc.
Embodiment 3
[0048] Example 3 Specific identification of the kit for detecting pullorum / Salmonella gallinarum typhi
[0049] Using the primers in the kit described in Example 2, using the genomes of different serotypes of Salmonella and other bacteria as templates, the distribution characteristics of the SPUL_2693 gene in different bacteria were identified by PCR.
[0050] The PCR reaction system is (25 μL): 9.5 μL double distilled water (ddH 2 O), 12.5 μL 2×Taq Master Mix, SPUL_2693-F 1 μL, SPUL_2693-R 1 μL, template 1 μL.
[0051] The PCR program is (a) 94°C for 5min; (b) 94°C for 45s; (c) 65°C for 30s; (d) 72°C for 2min16s, steps (b) to (d) cycled 25 times; (e) 72°C for 10min.
[0052] PCR products can be stored at 4°C.
[0053] PCR product carries out 1% agarose gel electrophoresis, and PCR electrophoresis result shows that all have 2160bp object band ( figure 2 , Figure 4 ), while other serotypes of Salmonella did not amplify the bands ( figure 2 , image 3 , Figure 4 ), sh...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


