Microorganism producing poly gamma-glutamic acid and construction method and application thereof

A technology of microorganisms and glutamic acid, applied in the fields of genetic engineering and microbial fermentation, to achieve the effect of promoting efflux, improving permeability and enhancing expression

Active Publication Date: 2018-08-17
HUBEI UNIV
View PDF6 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is still no research on the transmembrane transport process of γ-PGA and its application in promoting the efficient synthesis of γ-PGA

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Microorganism producing poly gamma-glutamic acid and construction method and application thereof
  • Microorganism producing poly gamma-glutamic acid and construction method and application thereof
  • Microorganism producing poly gamma-glutamic acid and construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1 Construction of pHY-plC expression plasmid

[0031] According to the gene sequence of the plC gene in the genome DNA sequence of Bacillus thuringiensis BM171, design the upstream primer (plC-F) and the downstream primer (plC-R) of plC gene; And take the genome DNA of Bacillus thuringiensis BM171 as template, respectively The upstream primer (plC-F) and downstream primer (plC-R) of the plC gene were used for PCR amplification to obtain a plC gene fragment with a length of 852bp (as shown in SEQ ID NO.2). The sequences of primers plC-F and plC-R are as follows.

[0032] SEQ ID NO.3:plC-F:TAAGAGAGGAATGTACACATGAAAAAGAAAGTACTTGCTT

[0033] SEQ ID NO.4:plC-R:TCCGTCCTCTCTGCTCTTTTAACGATTTCCGTACGTATCA

[0034] Using the genomic DNA of Bacillus subtilis 168 as a template and P43-F and P43-R as primers, the P43 promoter was amplified by PCR; using the genomic DNA of Bacillus licheniformis WX-02 as a template, TamyL-F and TamyL-R were Primers, amylase terminator TamyL ...

Embodiment 2

[0043] Example 2 Construction of Bacillus licheniformis WX-02 / pHY-plC

[0044] The free expression vector pHY-plC was transformed into Bacillus licheniformis WX-02 (this strain has been disclosed in Chinese patent CN106497857A), screened at 37°C on a medium containing tetracycline resistance, and obtained For the transformants, colony PCR verification was carried out on the extracted plasmids of the transformants (the primers used were: pHY-F and pHY-R). The PCR verification result of the positive transformant was an electrophoresis band at 1934bp, combined with the sequence determination results, it was proved that the free expression vector pHY-plC was successfully transferred into Bacillus licheniformis WX-02, and the Bacillus licheniformis engineering bacterium WX-02 / pHY- The construction of plC was successful, and the control strain WX-02 / pHY300 was to transform the plasmid pHY300 into WX-02, and the operation steps were the same as the construction of WX-02 / pHY-plC.

Embodiment 3

[0045] Example 3 Fermentation test of Bacillus licheniformis WX-02 / pHY-plC to produce γ-PGA

[0046] 1. Seed culture

[0047] Activate Bacillus licheniformis WX-02 / pHY-plC and WX-02 / pHY300, that is, inoculate 1% by volume from a glycerol tube into 5mL LB medium, culture at 180-300r / min at 37°C for 10 ~ 14 hours, and then inoculate the bacterium liquid after the activation of the strain in the LB medium with a volume percentage of 1% inoculum, and then cultivate it at 180 ~ 300 r / min and 37 ° C for 10 ~ 12 hours to obtain the seed culture bacterium liquid.

[0048] 2. Production of γ-PGA by fermentation

[0049] In order to better analyze the effect of the expression of plC on the fermentative production of γ-PGA by Bacillus licheniformis, fermentation experiments were carried out using the media shown in Table 1, respectively.

[0050] Table 1 Fermentation medium formula

[0051]

[0052]

[0053] The units of the above medium components are g / L.

[0054] 25-150 mL o...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a microorganism producing poly gamma-glutamic acid and a construction method and application thereof. The microorganism producing poly gamma-glutamic acid disclosed by the invention is a microorganism capable of overexpressing phospholipase C, and the overexpression is introducing one or a plurality of copied phospholipase C encoding genes and / or replacing the expression element of phospholipase C with an expression element with the relatively high activity. The microorganism is obtained by improving expression of phospholipase C, and the yield of poly gamma-glutamic acid produced through fermentation of the microorganism is obviously improved. The microorganism provides new strategies for improving the yield of poly gamma-glutamic acid produced through fermentation of the microorganism and reducing the production cost.

Description

technical field [0001] The invention relates to the fields of genetic engineering and microbial fermentation, in particular to a microorganism producing poly-γ-glutamic acid and its construction method and application. Background technique [0002] Poly-γ-glutamic acid (γ-PGA) is a kind of natural anionic biopolymer, mainly composed of L-glutamic acid and D-glutamic acid monomers through γ-amide bonds aggregated. The γ-PGA molecule has a large number of free negatively charged carboxyl groups, which makes it capable of combining with a large number of metal cations and has hydrophilic properties. These structural characteristics make γ-PGA have good water solubility, strong adsorption capacity, biodegradability, non-toxic to human body and environment, etc., and have a wide range of applications in the fields of medicine, food, cosmetics, environmental protection and agriculture. [0003] There are mainly two sources of L-glutamic acid as the synthetic precursor of γ-PGA, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12P13/02C12R1/10
CPCC12N9/16C12P13/02C12Y301/04003
Inventor陈守文莫非蔡冬波何鹏辉陈耀中王世依马昕
OwnerHUBEI UNIV