Method for establishing KI-T2A-luciferase cell line based on CRISPR/Cas9 targeted genome modification technology

A hek293-mmp12-t2a-luciferase-ki, cell line technology, applied in cells modified by introducing foreign genetic material, recombinant DNA technology, genetic engineering, etc. Expensive, unstable, etc.

Inactive Publication Date: 2018-09-21
SHAANXI NORMAL UNIV
View PDF2 Cites 35 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The RT-PCR process is cumbersome and unstable, and Western Blot antibody labeling is time-consuming and expensive, which are not conducive to high-throughput screening; due to the epigenetic modification of the genome itself, the method of cloning the promoter into the expression detection vector carrying the reporter gene Cannot simulate the true state of the genome, so it is difficult to accurately reflect the gene expression on the genome

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for establishing KI-T2A-luciferase cell line based on CRISPR/Cas9 targeted genome modification technology
  • Method for establishing KI-T2A-luciferase cell line based on CRISPR/Cas9 targeted genome modification technology
  • Method for establishing KI-T2A-luciferase cell line based on CRISPR/Cas9 targeted genome modification technology

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0065] Example 1: Design, synthesis and vector construction of sgRNA primers downstream of the stop codon targeting the target gene mmp12

[0066] (1) Select the downstream of the stop codon of the mmp12 gene as the targeting region (TSF), with a length of about 1000 bp;

[0067] (2) Find all NGGs and their first 12 bases in the TSF region and perform Blast at NCBI to screen out the sequence that exactly matches the target sequence and the only one (if there is no NGG that meets the requirements, look up CCN in reverse), reducing the potential off-target sites;

[0068] In this embodiment, 4 sgRNA primers are designed downstream of the stop codon of mmpl2, and the sequences are as follows:

[0069] The primer sequence of MMP12-sgRNA1 is: CTCTAAGTAGTGGTACACTG;

[0070] The primer sequence of MMP12-sgRNA2 is: GGTAACACCACTTGTGTCCT;

[0071]The primer sequence of MMP12-sgRNA3 is: CTAGGCTACACACAACCCCA;

[0072] The primer sequence of MMP12-sgRNA4 is: GCATGGTAAGCACATCATTC.

[0...

Embodiment 2

[0083] Example 2: Construction of vectors expressing sgRNA components and Cas9 genes

[0084] (1) After T7E1 enzyme detection, the sgRNA expression vector with high targeting efficiency is screened out;

[0085] (2) The sgRNA expression vector with high targeting efficiency and the Cas9 expression vector were digested with Kpn Ⅰ and Spe Ⅰ, respectively, and were recovered by agarose gel electrophoresis with a mass concentration of 1%, and the obtained fragments were connected to the vector, and after Enzyme digestion and sequencing identified positive clones. The obtained clone was named pCMV-Cas9-SV40pA-U6-sgRNA3-SV40pA (such as figure 1 shown).

Embodiment 3

[0086] Example 3: Construction of the targeting vector pUC19 / MMP12-donor targeting the mmp12 gene

[0087] The constructed targeting vector contains two sequences of 835 bp upstream of the targeting break site and 1112 bp downstream of it as the upstream and downstream homology arms of the targeting vector, wherein:

[0088] The upstream homology arm uses the primer MMP12up arm ClaⅠfor sequence

[0089] CATCGATGGTTGTCTAGCAGGCAGAGG, MMP12up arm Spe I reverse sequence GACTAGTACAACCAAAACCAGCTATTGC were obtained;

[0090] The downstream homology arm uses the primer MMP12down arm SalⅠfor the sequence

[0091] CGTCGACTAACTCAGGAGGGAGGCGTT and MMP12down arm BglⅡ reverse sequence AAGATCTAGTCCACAAGGTAGACAGTCCT were obtained.

[0092] Then combine it with the T2A-luciferase reporter gene and positive screening element preserved in our laboratory

[0093] CMV-eGFP-T2A-Neomycin-SV40pA and negative sieve element

[0094] PGK-TK-T2A-mCherry-SV40pA was connected to the pU19 expression vec...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses a method for establishing KI-T2A-luciferase cell line based on CRISPR / Cas9 targeted genome modification technology. A T2A-luciferase reporter gene is integrated in the3<rd> end of the mmp 12 gene in a genome by using CRISPR / Cas9 technology. A knock-in cell line of MMP12-T2A-luciferase is established, the site-specific integration of the source gene in the cell lineon the genome is verified. Meanwhile, a reported transcription factor, STAT3, with activation effect on mpp12-T2A is used to transcribe and active the MMP12-T2A-luciferase cell line. The results showthat the expression level of luciferase in MMP12-T2A-luciferase cell line can accurately and sensitively reflect the expression level of MMP12 protein in the cell line. The establishment of the cellline will contribute to the study of the gene function of mmp12 and the screening of small molecule chemical drugs affecting the expression of mmp12, which provides a new experimental thinking and solution for the migration of cancer cells and related researches thereof.

Description

technical field [0001] The invention belongs to the field of molecular biology, and relates to the establishment of cell lines using CRISPR / Cas9-mediated targeted genome insertion technology, in particular to a HEK293-MMP12-KI-T2A-luciferase cell line established based on CRISPR / Cas9 targeted genome modification technology A new method for monitoring the expression and activity of endogenous mmp12 can be used for screening drugs that have an effect on mmp12. Background technique [0002] CRISPR / Cas9 technology is artificially engineered from the type II CRISPR / Cas9 acquired immune system present in bacteria and archaea, which can achieve highly flexible and specific genome editing in eukaryotic cells. The system uses CRISPR-derived RNA (crRNA) to form a complex with trans-activating RNA through base pairing. Under the guidance of this complex, Cas9 endonuclease performs site-specific cutting of the sequence paired with crRNA. Therefore, by artificially designing a sgRNA (si...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N5/10C12N15/113C12N15/85C12N15/65
CPCC07K14/47C12N15/113C12N15/65C12N15/85C12N2310/10C12N2310/20
Inventor夏海滨杜春花赵俊丽
OwnerSHAANXI NORMAL UNIV