DNA polymerase, nucleic acid test method and nucleic acid test kit

A polymerase and kit technology, applied in the field of nucleic acid detection, can solve the problems of high RNA template ratio requirements, unsatisfactory reverse transcription amplification efficiency, etc., and achieve the effects of short detection time, low cost and high specificity

Active Publication Date: 2018-09-28
BEIJING EXELLON MEDICAL TECH CO LTD
View PDF29 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this reverse transcription system requires a high ratio of DNA polymerase: RNA template, and the efficiency of reverse transcription amplification is not ideal (Proc.Nat.Acad.Sci USA Vol.71, No.4, pp.1035-1039, 1974 )

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • DNA polymerase, nucleic acid test method and nucleic acid test kit
  • DNA polymerase, nucleic acid test method and nucleic acid test kit
  • DNA polymerase, nucleic acid test method and nucleic acid test kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0091] Embodiment 1 DNA polymerase of the present invention and the activity of former Klenow large fragment

[0092] In this example, the activities of the modified Klenow large fragment (MT-Klenow) and the wild-type Klenow large fragment (WT-Klenow) were compared (that is, the amino acid substitutions described herein were introduced). Using the same RNA template and primers, MT-Klenow and WT-Klenow were used to perform isothermal nucleic acid amplification under the same conditions. The RNA template sequence used is:

[0093] CAGGGAGGUGCCUUGAUGACAUAGAAGAAGAACCAGAUGAUGUUGAUGGCCCAACUGAAAUAGUAUUAAGGGACAUGAACAACAAAGAUGCAAGGCAAAAGAUAAAGGAGGAAGUAAACACUCAGAAAGAAGGGAAGUUCCGUUUGACAAUAAAAAGGGAUAUGCGUAAUGUAUUGUCCCUGAGAGUGUUAGUAAACGGAACAUUCCUCAAACACCCCAAUGGAUACAAGUCCUUAUCAACUCUGCAUAGAUUGAAUGCAUAUGACCAGAGUGGAAGGCUUGUUGCUAAACUUGUUGCUACUGAUGAGCUUACAGUGGAGGAUGAAGAAGAUGGCCAUCGGAUCCUCAAUUCACUCUUCGAGCGUCUUA(SEQ ID NO:19);

[0094] The forward primer sequence is CAGGGAGGTGCCTTGATGACATAGAAGAAG...

Embodiment 2

[0100] Embodiment 2: comparative experiment of stem-loop structure primer and linear primer

[0101] The 3' end of the stem-loop structure primer of the present invention is completely identical or completely complementary to the nucleic acid target sequence; an additional 2-15 nt base is added to the 5' end of the primer to form a stem-loop structure complementary to the 3' end of the primer; or 5' The base of 2-15nt is added to the end, and it is complementary to the base of 1-10nt from the 3' end to form a stem-loop structure with a foothold.

[0102] According to the above design principles of stem-loop primers, the present invention compared the isothermal amplification reactions of a pair of common linear primers and their stem-loop primers experimentally. 其中DNA模板序列为:5'-GACAGACTGCACAGGGCATGGATTACTTACACGCCAAGTCAATCATCCACAGAGACCTCAAGAGTAATAATATATTTCTTCATGAAGACCTCACAGTAAAAATAGGTGATTTTGGTCTAGCTACAGAGAAATCTCGATGGAGTGGGTCCCATCAGTTTGAACAGTTGTCTGGATCCATTTTGTGGATGGCACCAGAAGTCATCAG...

Embodiment 3

[0106] Example 3 utilizes RINA-CAS (using LwCas13a) technology to detect samples containing influenza B virus (Influenza B)

[0107] First, nucleic acid was extracted from the Influenza B (subtype B influenza virus yamagata) sample, and the nucleic acid extraction kit was Qiagen's viral RNA extraction kit (QIAamp Viral RNA Mini Kit). A sample without Influenza B was used as a negative control.

[0108] Take 1 μL of the extracted RNA and add it to the nucleic acid amplification reaction system at a concentration of 10 -5 Two amplification primers of M Influenza Primer F (sequence is: 5'- ACCAACTTAATACGACTCACTATAGGTGAAACTGCGGTGGGAGTCTTATCCCAAGTTGGT-3' (SEQ ID NO: 6)), Influenza Primer R (sequence: 5'- TGGTTG TCACAAGCACTGCCTGCTGTACACTTCAACCA-3' (SEQ ID NO: 7)) each 2.4 μL, incubated at 37°C for 15 minutes. The designed primers were directed against the conserved gene InfluenzaB NS1 of the yamagata subtype of influenza B virus. The volume of the amplification reaction system...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a DNA polymerase with DNA or RNA as a template. The DNA polymerase is obtained through amino acid replacement, including G198W, V222I, E306K, Q354E, A381E and E582K, of klenow fragments of escherichia coli polymerases I. The invention also provides a primer with a stem loop structure and used for constant-temperature nucleic acid amplification. The invention further providesa nucleic acid test technique and a test kit both based on combination between rapid constant-temperature nucleic acid amplification and a Cas test system. The DNA polymerase, the nucleic acid test technique and the test kit can be used for testing nucleic acid targets in test samples at a constant temperature, have the advantages of low cost, short test time, simplicity and convenience in operation, high specificity, high sensitivity and the like, and are particularly applied to POCT (point-of-care testing).

Description

technical field [0001] The invention relates to a nucleic acid detection technology, in particular to a nucleic acid detection technology combining constant temperature nucleic acid amplification and Cas detection. Background technique [0002] Nucleic acid detection technology has great application value in molecular diagnosis, biochemical analysis, and disease diagnosis, for example, it can be used for nucleic acid detection of viruses, bacteria, pathogens, nucleic acid disease markers, etc. PCR (polymerase chain reaction, polymerase chain reaction) technology is currently the most widely used nucleic acid detection technology. The technology was invented by Dr.Mullis in 1983, and it is mainly divided into three basic steps, namely: denaturation, annealing and extension. PCR technology needs to achieve nucleic acid amplification through repeated heating and cooling, which has high requirements for instruments and operating environment. The instruments are sophisticated, e...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/12C12N15/54C12N15/11C12Q1/6844C12Q1/70C12R1/93
CPCC12Q1/6844C12Q1/708C12Q1/701C12N9/1252C12N9/1276C12Y207/07007C12Y207/07049C12Q2525/301C12Q2521/101C12Q2521/107C12Q2521/507C12Q2521/513C12Q2521/327Y02A50/30
Inventor梁振伟杜晋鲁王一凡蒲珏
OwnerBEIJING EXELLON MEDICAL TECH CO LTD