Kit and detection method for specifically detecting lily cucumber mosaic virus

A technology for lily cucumber and mosaic virus, which is applied in the directions of biochemical equipment and methods, microbial determination/inspection, etc., can solve the problem of high technical requirements, and achieve the effects of improving detection efficiency, reliable results and easy operation.

Pending Publication Date: 2018-10-09
NORTHWEST INST OF ECO-ENVIRONMENT & RESOURCES CAS
View PDF7 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] The technical problem to be solved by the present invention is to overcome the defects and deficiencies in the existing lily CMV virus detection method that require high technical requirements and rely on professional instruments and equipment, and provide a method that can specifically and efficiently detect lily cucumber flowers and leaves without the need for molecular biology professional instruments and equipment. The IC-RT-LAMP method for viruses;

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit and detection method for specifically detecting lily cucumber mosaic virus
  • Kit and detection method for specifically detecting lily cucumber mosaic virus
  • Kit and detection method for specifically detecting lily cucumber mosaic virus

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0053] Example 1 Obtaining positive reference substance

[0054] 1. Extraction of total RNA

[0055] 50-100 mg of Lanzhou lily leaves infected with CMV were ground in liquid nitrogen, and total RNA from diseased tissues was extracted with a plant total RNA extraction kit.

[0056] 2. Primer design and synthesis

[0057] According to the Lily CMV CP gene sequence registered on GenBank (GenBank accession number: DQ767971), a pair of specific forward (CMV-F) and reverse primers (CMV-R) were designed and synthesized. The above primer sequence is as follows:

[0058] CMV-F: 5’- TTCCTGCCTCCTCGGACTTA -3’;

[0059] CMV-R: 5’-CACTCCGGACGTGGGAATAC-3’.

[0060] 3. Preparation of positive control substance

[0061] 1) RT reaction

[0062] Using Lanzhou lily CMV reverse primer CMV-R and M-MLV reverse transcriptase for RT reaction, the first strand of cDNA was synthesized.

[0063] The 10μL RT reaction system is as follows: Total RNA 2μL, 10μM CMV specific reverse primer CMV-R 1μL, DEPC-H 2 O 3μL, denatu...

Example Embodiment

[0073] Example 2 Establishment of a method for detecting lily CMV by immunocapture IC-RT-LAMP

[0074] 1. The preparation method of rabbit anti-CMV polyclonal antibody IgG in the present invention:

[0075] 1) Purification of CMV natural virus particles: Take 50g of frozen infected CMV Lanzhou lily leaves, add 200mL 0.5M, pH7.0 citric acid buffer containing 0.05% β-mercaptoethanol and 0.01 M EDTA, and place in a frozen mortar Grind to homogenize, filter with 4 layers of gauze, and take the filtrate; add 100mL carbon tetrachloride to the filtrate, shake vigorously, and stir for 15 min; centrifuge at 5000g for 15 min, save the supernatant, discard the precipitate; add 7.5% to the supernatant PEG 6000 (W / V) and 4% sodium chloride (W / V) are stirred to dissolve and then let stand for 30 min, centrifuge at 8000g for 20 min; retain the precipitate, resuspend in 0.05M, PH7.0 containing 2% Triton X-100 In citric acid buffer solution, overnight at 4℃; centrifuge at 10000g for 20 min, save t...

Example Embodiment

[0097] Example 3 Immune capture IC-RT-LAMP detects the specificity of CMV

[0098] In order to analyze the specificity of immunocapture IC-RT-LAMP for detecting lily CMV, the infected leaves of the three main viruses that most commonly infect lilies (CMV, lily cryptovirus-LSV and lily mottle virus-LMoV) were used as samples, respectively. CMV polyclonal antibody IgG was used to capture virus particles, and the IC-RT-LAMP detection system in the above example was used for reaction. With healthy lily leaves as a negative control, the experiment was repeated 3 times.

[0099] The results of agarose gel electrophoresis showed that, except for lily leaves infected with CMV, which could amplify the diffuse nucleic acid bands, the other samples did not amplify nucleic acid bands. This indicates that the IC-RT-LAMP method established by the present invention has good specificity.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides an IC-RT-LAMP (Immune Capturing-Reverse Transcription-Loop-Mediated Isothermal Amplification) kit and detection method for specifically detecting a lily cucumber mosaic virus CMV. The kit mainly comprises a specific CMV antibody IgG, a specific RT reverse primer CMV-R, a specific LAMP primer group, a first-chain cDNA (complementary Deoxyribonucleic Acid) synthesis reagent, an LAMP amplification reaction reagent, a fluorescent dye detection solution, a negative reference substance and a positive reference substance; the specific LAMP primer group is composed of a frontward outer primer F3, a backward outer primer B3, a frontward inner primer FIP, a backward inner primer BIP, a positive loop primer LF and a backward loop primer LB; the negative reference substance is ddH2O and the positive reference substance is a Lanzhou lily CMV CP gene standard product. According to the kit provided by the invention, RNA (Ribonucleic Acid) does not need to be extracted and molecular biology special instruments and equipment including an enzyme labeling instrument, a PCR instrument or a fluorescent quantitative PCR instrument and the like are not needed; amplification reaction can be finished in a constant-temperature water bath, and the specificity and sensitivity are high; the kit is convenient to operate and has high applicability; the kit can be used for monitoring generation, spreading and prevalence of the lily CMV and is suitable for being popularized and applied in grassroots.

Description

technical field [0001] The invention relates to an IC-RT-LAMP kit for specifically detecting lily cucumber mosaic virus CMV and a detection method thereof. Background technique [0002] Lily is an important economic crop that integrates ornamental, edible and medicinal uses. Long-term asexual reproduction causes the accumulation of viruses, which seriously affects the yield and quality. Among them, cucumber mosaic virus (CMV) is the most common occurrence. One of the viruses, taking edible lily in Lanzhou as an example, the latest field survey results of viral diseases show that the infection rate of CMV reached 42.5% (Zhang et al., 2018). important factor. [0003] CMV is a typical member of the genus Cucumovirus in the Bromoviridae family. It is distributed worldwide, and its host range is found in dicotyledonous and monocotyledonous plants. As many as 1000 species have been elucidated. More than one species; the molecular weight of CMV virus particles is between 5000 an...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/70C12Q1/6844C12Q1/6804
CPCC12Q1/6804C12Q1/6844C12Q1/701C12Q2531/119C12Q2563/107C12Q2565/531
Inventor 张玉宝王亚军谢忠奎王若愚郭志鸿邱阳何玉惠
Owner NORTHWEST INST OF ECO-ENVIRONMENT & RESOURCES CAS
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap