Type B hemophilia lentiviral vector, lentivirus and preparation method and application thereof

A lentiviral vector and hemophilia technology, applied in the field of genetic engineering, can solve the problems of restricting the application of AAV and high immunogenicity, and achieve the effects of strong stability, good safety and high transfection efficiency

Inactive Publication Date: 2018-10-19
SHENZHEN GENO IMMUNE MEDICAL INST
View PDF7 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There are also many medical adeno-associated virus (Adeno associated virus, AAV) vectors carrying liver-specifically activated FIX protein for gene therapy in mice. The results show that a certain amount of FIX protein can be expressed in mice, and can reach a therapeutic dose. However, it cannot achieve long-term and effective expression of the gene in vivo
In addition, the immunogenicity of AAV vectors is high, and the probability of human beings being exposed to AAV and producing antibody responses to it is high, which limits the application of AAV in the field of gene therapy to a large extent.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Type B hemophilia lentiviral vector, lentivirus and preparation method and application thereof
  • Type B hemophilia lentiviral vector, lentivirus and preparation method and application thereof
  • Type B hemophilia lentiviral vector, lentivirus and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0065] Example 1 Construction of Lentiviral Vector

[0066] This embodiment provides a method for constructing a lentiviral vector, which specifically includes the following steps:

[0067] (1) The schematic diagram of the transformation of the lentiviral vector pTYF is as follows figure 1 As shown, the specific mutation is to mutate the wild-type 5'splice donor site GT to CA, and delete the enhancer in U3. For the specific modification method, please refer to "Contributions of Viral Splice Sites and cis-Regulatory Elements to Lentivirus Vector Function, YAN CUI,JOURNAL OF VIROLOGY,July 1999,p.6171–6176", as follows:

[0068] Modification of 5'splice donor site:

[0069] Wild type (SEQ ID NO.3): GGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTA;

[0070] Mutant (SEQ ID NO.4): GGCAAGAGGCGAGGGGCGGCGACTGCAGAGTACGCCAAAAATTTTGACTAGCGGAGGCTA;

[0071] (2) Insertion of promoter and FIX gene:

[0072] The normal FIX gene sequence (shown in SEQ ID NO. 1) was synthesized by the whole ge...

Embodiment 2

[0077] Example 2 Preparation and identification of lentivirus

[0078] 1) Preparation of lentivirus

[0079] The lentiviral vector prepared in Example 1 was further packaged, purified and concentrated to obtain the lentivirus. The specific process is as follows: image 3 As shown, the specific steps are as follows:

[0080] (1) Co-transfect the lentiviral vector constructed in Example 1 with the packaging auxiliary plasmid pNHP and pHEF-VSV-G into mammalian cells HEK293T and culture for 24-72h;

[0081] (2) Purifying and concentrating the lentivirus obtained by the culture to obtain the lentivirus.

[0082] 2) Identification of lentivirus

[0083] The collected FT902 mesenchymal stem cells after transfection with the normal FIX gene are subjected to protein expression identification to determine the expression of FIX gene in neuronal cells. The protein expression is as follows Figure 4 Shown.

[0084] From Figure 4 From the results, it appears that there is no expression of FIX protein ...

Embodiment 3

[0086] Example 3 Therapeutic effect of lentivirus

[0087] The lentiviral vector of the present invention prepared in Example 2 carries the normal FIX transfection to obtain the dual stem cell system to treat hemophilia B disease. Figure 5 As shown, after mobilizing the patient’s stem cells, the peripheral blood of the patient is collected and the hematopoietic stem cells and mesenchymal stem cells are separated. The double stem cells are transfected with the lentiviral vector carrying the normal FIX gene to obtain the stem cells carrying the normal FIX gene. The cells are injected intravenously The method is imported into the patient's body for disease treatment.

[0088] It can be seen from the results that direct injection of lentivirus can effectively improve the delivery efficiency and expression of FIX gene in the bone marrow.

[0089] In summary, the lentiviral vector of the present application can directly repair damaged FIX genes in cells, and can effectively improve the d...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a type B hemophilia lentiviral vector, a lentivirus and a preparation method and application thereof. The lentiviral vector is obtained by modifying a splicing donor site of a 5' end of the pTYF lentiviral vector, wherein the lentiviral vector further comprises an FIX gene. The FIX gene is specifically connected on the basis of the modified lentiviral vector, the safety canbe ensured and more efficient gene transmission is realized, so that the expression amount of the FIX gene in bone marrow related cells is remarkably increased, and the transmission of normal genes ina gene treatment process of type B hemophilia can be more efficiently finished.

Description

Technical field [0001] The present invention belongs to the technical field of genetic engineering, and relates to a type B hemophilia lentiviral vector, a lentivirus, and a preparation method and application thereof, and more particularly to an improved lentiviral vector to optimize expression of FIX gene for preparing and treating type B Medications for hemophilia. Background technique [0002] Hemophilia B (Hemophilia B) is a bleeding disorder in which the body's coagulation dysfunction is caused by FIX deletion or insufficiency caused by the body's FIX gene mutation. The FIX activity in the plasma of hemophilia B patients is lower than 40% of the normal level, and the disease is divided into three types according to the activity of this factor in the plasma: severe ( <1%), moderate (1%-5%), mild (5%-50%). In patients with this disease, active thromboplastin is impaired, the clotting time is prolonged, and there is a lifelong tendency to hemorrhage after minor trauma, and ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/867C12N7/01C12N5/10A61K48/00A61K38/17A61P7/04
CPCA61K38/17A61K48/0025A61K48/005A61P7/04C12N5/0634C12N5/0665C12N15/86C12N2510/00C12N2740/15043A61K48/0008C12N5/0647C12N5/0663C12N9/644C12N2740/16043C12N2740/16051C12Y304/21022
Inventor郭筱璐
OwnerSHENZHEN GENO IMMUNE MEDICAL INST