Effective Cas13a-based anti-dengue virus nucleic acid target and application thereof
A dengue virus and target technology, which is applied in the field of nucleic acid targets against dengue virus, can solve the problems of inability to target and clear RNA viruses, and achieve the effects of less drug resistance, strong specificity, and high efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Example 1. Preparation and screening of CRISPR-Cas13a target sequence targeting dengue virus
[0037] 1. Design and synthesis of crRNA sequence targeting dengue virus DENV-2
[0038] Taking the genome sequence (Genebank ID: U87411) of type 2 dengue virus DENV-2 (strain 16681) as the reference sequence, for the 6 genes (PrM, NS2a, NS2b, NS3, NS4a, 3'UTR) of type 2 dengue virus, A continuous 29 nucleotide sequence was selected in each gene sequence as the target sequence of the CRISPR-Cas13a system.
[0039] The selected 6 target sequences were respectively reverse-complemented to obtain 6 reverse-complementary strands;
[0040] Then add GGGGATTTAGACTACCCCAAAAACGAAGGGGACTAAAAC to the 5' end of the sequence of the 6 reverse complementary strands to synthesize the forward oligonucleotide sequence (Table 1);
[0041] Using the forward oligonucleotide sequence as a template, use T7-crRNA-F: TAATACGACTCACTATAGGGGATTTAGACTACCCCAA as an upstream primer, and use R-NNN (Table 1:...
Embodiment 2
[0076] Example 2. Efficiency of CRISPR-Cas13a system targeting crRNA-NS3 inhibiting dengue virus replication and expression in vitro
PUM
Property | Measurement | Unit |
---|---|---|
molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap