Method for constructing human neuroblastoma cell line of which CAPNS1 gene is knocked out based on CRISPR/Cas technology

A technology of human nerves and mother cells, applied in the field of genetic engineering, can solve the problems of low transfection efficiency, difficulty in exploring transfection conditions, and difficulty in transfecting plasmids.

Inactive Publication Date: 2018-11-06
NANHUA UNIV
View PDF0 Cites 23 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, the concentration of Cas9 protein or sgRNA also affects off-target activity
[0007] Compared with other cells, the culture of nerve cells is more harsh, and it is a cell line that is difficult to transfect plasmids, and the transfection efficiency is low, and the damage of electroporation to nerve cells is also greater. Therefore, it is difficult to explore the transfection conditions. not easy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for constructing human neuroblastoma cell line of which CAPNS1 gene is knocked out based on CRISPR/Cas technology
  • Method for constructing human neuroblastoma cell line of which CAPNS1 gene is knocked out based on CRISPR/Cas technology
  • Method for constructing human neuroblastoma cell line of which CAPNS1 gene is knocked out based on CRISPR/Cas technology

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0040] 1) Designing Crispr / cas9 knockout target sites

[0041] First, a pair of oligo DNA of about 20bp needs to be designed in the target DNA region through the following online tools:

[0042] CRISPR Design at MIT: http: / / crispr.mit.edu /

[0043] Select the common CDS region of all transcripts of the CAPNS1 gene, find out the exons where the common CDS region is located for target site design, and select the fourth and fifth exons for target site design.

[0044] 3 target site sequence information:

[0045] CAPNS1-gRNA1: AGTTCGACACTGACCGATCAGGG (SEQ ID NO.1)

[0046] CAPNS1-gRNA2: TGAACTCCCAGGTGCCTTTGAGG (SEQ ID NO.2)

[0047] CAPNS1-gRNA3: CACTTTCATCTGAGTAGCGTCGG (SEQ ID NO.3)

[0048] 2) Add adapters to primers

[0049] Primer synthesis needs to add extra bases to the head of the target sequence, add CACC to the forward primer, and add AAAC to the reverse primer. It is important to note that the first base of the target sequence must be G. If the target sequence you c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of genetic engineering and particularly relates to a method for constructing a human neuroblastoma cell line of which a CAPNS1 gene is knocked out based ona CRISPR / Cas technology. The invention provides the method for knocking out the CAPNS1 gene of human neuroblastoma cell. After plasmid transfection into SK-N-SH cells, a monoclonal antibody is prepared. After Cruiser<Tm> Enzyme digestion, the clone is positive clone. The monoclonal sequencing result shows that the CAPNS1 gene-free SK-N-SH cell line is successfully constructed. In the CAPNS1<- / ->group, the CAPNS1 protein and Calpain1 and Calpain2 protein levels are significantly reduced. The result shows that the CAPNS1 gene-free SK-N-SH cell line is successfully constructed.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a method for knocking out the CAPNS1 gene of human neuroblastoma cells. Background technique [0002] Calpain is a group of highly conserved specific Ca 2+ Dependent intracellular neutral protease, whose activity is mainly related to intracellular Ca 2+ Concentration related. Calpain plays an important role in the physiological process of the body. It is not only related to the hydrolysis of intracellular proteins, but also participates in normal processes such as autophagy, cell cycle regulation and apoptosis, cytoskeleton remodeling, glucose transport, and cell signal transduction. Physiological process [3,4]. A soluble Ca was discovered for the first time in rat brain tissue 2+ Since relying on dispase, researchers have paid more and more attention to the role of this protease in the body. At present, studies have found that there are 15 isoforms of calpain in...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/90C12N15/85C12N5/10
CPCC12N5/0693C12N9/22C12N9/6472C12N15/113C12N15/85C12N15/907C12N2310/10C12N2510/00C12Y304/22052
Inventor龙鼎新朱家佳李小玲杨越唐乖
OwnerNANHUA UNIV