Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Multiple liquid-phase chip detection method for swine viral diarrhea pathogens and construction of multiple liquid-phase chip detection method

A technology for swine viral diarrhea and liquid phase chip detection, which is applied to the multiple liquid phase chip detection method and construction field of porcine viral diarrhea pathogens, and can solve the problem of poor probe specificity, increased test errors, and increased uncertain factors, etc. question

Active Publication Date: 2018-11-30
SHANGHAI ACAD OF AGRI SCI
View PDF3 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In this method, the probe sequence needs to be designed by itself. As the number of pathogens increases, the difficulty of probe design also increases, resulting in poor probe specificity; and in the microsphere coupling process, artificial uncertain factors are added. lead to increased experimental error

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Multiple liquid-phase chip detection method for swine viral diarrhea pathogens and construction of multiple liquid-phase chip detection method
  • Multiple liquid-phase chip detection method for swine viral diarrhea pathogens and construction of multiple liquid-phase chip detection method
  • Multiple liquid-phase chip detection method for swine viral diarrhea pathogens and construction of multiple liquid-phase chip detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0096] The construction of the multiple liquid phase chip detection method of embodiment 1 porcine viral diarrhea pathogen comprises the following steps:

[0097] 1. Primer design and modification

[0098] First, use Oligo7 software to analyze 11 viral diarrhea pathogens in pigs, namely PEDV, TGEV, PDCoV, PoRV, BVDV, PSV, PKV, PAstV, PToV, PTV and PSaV, design PCR primers, and screen for suitable TAG sequences;

[0099] The sequences of the PCR primers of 11 kinds of viral diarrhea pathogens of pigs are respectively as follows:

[0100] PToV upstream primer: AATTGCTTATTGGTGGCTTC;

[0101] Downstream primer: AGCDATTTGRGCDGCATTC;

[0102] PDCoV upstream primer: CGCAGTTTTCATTGTGTCCA;

[0103] Downstream primer: CCTGTGGCGGATTTCTAACT;

[0104] PAstV upstream primer: CCTTWCCCCACTGATGAAGA;

[0105] Downstream primer: CCTGTCCATCTGCCTTTCTGT;

[0106] PKoV upstream primer: CGCCGTTCACTCTTTGTCC;

[0107] Downstream primer: ACCAAGCAGCATCCTACCAG;

[0108] PSV upstream primer: CTGGACTG...

Embodiment 2

[0167] Example 2 Liquid-phase chip detection and analysis of clinical porcine viral diarrhea samples

[0168] Using the liquid phase chip detection method in Example 1, 173 parts of porcine diarrhea feces samples were detected, and a negative control was set up in the detection, and carried out in a duplicate hole mode to obtain two groups of data in parallel experiments, and the average value of the two groups of data was taken, and each Data analysis was performed on each sample, and one of the samples was taken as an example. See Table 3 for the two groups of MFI values ​​and negative control values ​​obtained from the detection.

[0169] 1. The qualitative analysis process is as follows:

[0170] 12#xTAG microspheres: sample cMFI=[MFI(sample)-MFI(negative control)] / MFI(negative control)=0.99<3, PoRV negative;

[0171] 14#xTAG microspheres: sample cMFI=[MFI(sample)-MFI(negative control)] / MFI(negative control)=0.15<3, PSV negative;

[0172] 19#xTAG microspheres: sample cMF...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a multiple liquid-phase chip detection method for swine viral diarrhea pathogens and construction of the multiple liquid-phase chip detection method. The method comprises the following steps: according to the gene sequences of the swine viral diarrhea pathogens, screening out suitable TAG sequences, and coupling the suitable TAG sequences to a microballoon; marking TAG complementary sequences to 5'terminals of upstream primers of PCR primers of the pathogens, and marking biotin at the 5'terminals of downstream primers of the PCR primers; and carrying out multiple PCR amplification by utilizing a modification primer, carrying out hybridization on the PCR amplification products and the TAG sequences coupled to the microballoon, detecting the MFI value, and judging thefeminine gender or masculine of the detection result according to the MFI value. With the method, the detection specificity and sensitivity are improved, the qualitative and quantitative detection formultiple pathogens of the swine viral diarrhea is realized, and in addition, the method has the advantages of high throughput, time and labor conservation, strong specificity, high sensitivity and the like, and can satisfy the demand of simultaneously detecting various pathogens.

Description

technical field [0001] The invention belongs to the technical field of veterinary biological products, and in particular relates to a multiple liquid-phase chip detection method for porcine viral diarrhea pathogens and its construction. Background technique [0002] The porcine diarrhea epidemic caused by the virus has a wide range of epidemics, and the incidence of piglets is high, and the mortality rate can be as high as 100%. And multi-pathogen infection, co-infection is more common. Clinically, it is difficult to determine the main predisposing etiology, which brings difficulties to diagnosis and control. [0003] The main viruses causing porcine diarrhea are porcine epidemic diarrhea virus (Porcine epidemic diarrhea virus, PEDV), porcine deltacorona virus (Porcine deltacorona virus, PDCoV), porcine transmissible gastroenteritis virus (Porcine transmissible gastroenteritis virus, TGEV), pig Porcineteschvirus (PTV), bovine viral diarrhea virus (BVDV), porcine rotavirus ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/6837
CPCC12Q1/6837C12Q1/701C12Q2600/16C12Q2531/113C12Q2537/143C12Q2565/501
Inventor 刘惠莉陶洁李本强马玉飞程靖华石迎饶柏钟
Owner SHANGHAI ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com