Unlock instant, AI-driven research and patent intelligence for your innovation.
Primer probe composition for detecting BRAF gene mutation and application thereof
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A primer probe and mutation detection technology, applied in the field of molecular biology, can solve the problems of difficult mutation detection, high detection cost, and long turnaround time, and achieve the effects of prolonging survival time, high sensitivity, and improving sensitivity
Inactive Publication Date: 2018-12-07
天津脉络医学检验有限公司
View PDF2 Cites 0 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
Compared with next-generation sequencing (NGS) technology, NGS has a complex process, long turnaround time, and high testing costs, and it is often difficult to detect mutations in less than 5% of body fluids
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
[0078] Positive quality control product: a BRAF gene fragment containing a mutation site, the nucleotide sequence of the gene fragment is shown in SEQID NO.4;
[0079] BRAF gene fragment (SEQ ID NO.4) containing the mutation site: AATTCATACAGAACAATCCCAAATGCATATACATCT;
[0084] (1) Design specific primers based on the upstream and downstream regions of V600E of the BRAF gene, and the obtained upstream and downstream specific primer sequences are as follows:
[0085] SEQ ID NO.1:5'-TCATAATGCTTGCTCTGATAGGA-3';
[0086] SEQ ID NO.2:5'-GGCCAAAAATTTAATCAGTGGA-3';
[0087] The specific probe of the V600E mutation site of the BRAF gene adds FAM group and MGB group to the 5' and 3' ends respectively, and the obtained specific probe sequence is as follows:
[0088] Specific probe (SEQ ID NO.3): FAM-GAACAGAGAAAG-MGB.
[0089] (2) Prepare the quantitative reaction system of the probe method, oscillate and mix, and centrifuge to remove air bubbles. The reaction system is shown in Table 2:
[0098] Compared with Example 2, except that the PCR reaction conditions are pre-denaturation at 98°C for 3min, 93°C for 45s; annealing at 55°C for 45s; extension at 75°C for 30s, cycled 45 times, and finally 70°C for 12min, other conditions are the same as in Example 2 .
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Login to View More
Abstract
The invention relates to a product for detecting genemutation, and particularly relates to a primer probe composition for detecting BRAF gene mutation and an application thereof. The primer probe composition comprises a detection primer probe, a primer probe composition for detecting V600E mutation of the BRAF gene with ddPCR, a BRAF gene V600E mutation detection specificity primer pair and a BRAF gene specific probe. The primer probe composition has strong BRAF gene mutation specificity and high sensitivity, can realize absolute quantification of nucleotide and detection of rare allele, hasthe detection effect for ctDNA and other trace substances superior to that of a new generation sequencing technology, can be used for detecting a tumor tissue sample to assist clinical treatment, andhas an important value.
Description
technical field [0001] The invention belongs to the technical field of molecular biology, and relates to a product for detecting gene mutation, in particular to a combination of primers and probes for detecting BRAF gene mutation and its application. Background technique [0002] Murine sarcomavirusoncogene homolog B1 (v-raf murine sarcoma viral oncogenehomolog B 1, BRAF) gene mutation drives the proliferation, growth and differentiation of tumor cells, especially in colorectal cancer, thyroid papillary carcinoma, hairy cellleukemia, Brain tumors and melanoma account for a prominent proportion. [0003] More than 30 BRAF mutations have been detected so far, among which V600E accounts for more than 80% and is the most common BRAF activating mutation. The BRAF V600E mutation can lead to the continuous activation of the RAF / mitogen-activated proteinkinase (MAPK) signaling pathway, causing changes in the differentiation, proliferation, metabolism, and growth of tumor cells....
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to View More 
Login to View More