Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Pathogenic mutations in primary immunodeficiency diseases and their application

An immunodeficiency disease, primary technology, applied in the field of molecular biomedicine, can solve the problems of variable clinical phenotypes and multiple pathogenic genes

Active Publication Date: 2021-11-09
SHENZHEN HUADA GENE INST
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since PID is a genetically heterogeneous disease with variable clinical phenotypes and many pathogenic genes, there are still many related pathogenic genes and pathogenic mutations that have not been discovered. Therefore, the research work on PID still needs to be further developed.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1: Acquisition of pathogenic mutations

[0024] 1. Sample collection

[0025] The applicant collected 30 patient samples from the Nephrology and Immunology Department of Shenzhen Children's Hospital, specifically the peripheral blood of the patients. All patients signed informed consent, and the project was reviewed and approved by the Huada Gene Ethics Committee.

[0026] Screening criteria: patients have repeated infection, inflammation and other symptoms, after comprehensive analysis of CRP + blood routine (five classifications), humoral immune function test, lymphocyte immune analysis and other test results, it is suspected that the immune function is abnormal.

[0027] 2. Target region capture and high-throughput sequencing

[0028] The applicant searches and consults relevant literature on primary immunodeficiency diseases, and collects information on genes related to immune function, including but not limited to genes that have been confirmed in researc...

Embodiment 2

[0047] Embodiment two: a kind of kit for detecting PID pathogenic mutation comprising primer pair

[0048] This example discloses a kit for detecting PID pathogenic mutations, the reagents of the kit include the following two sets of primer pairs:

[0049] 1) The first set of primer pairs can detect the c.220T>A mutation on the IL2RG gene:

[0050] Upstream primer (5'-3'): AGACTTGCTACCCTCTCTCTTG (as shown in SEQ ID NO: 1).

[0051] Downstream primer (5'-3'): CCTCCTCCTTCTGACCATCATT (shown in SEQ ID NO:2).

[0052] 2) The second set of primer pairs detects the c.141+3A>T mutation on the CYBB gene:

[0053] Upstream primer (5'-3'): GTTTGGCTGGGGTTGAACG (as shown in SEQ ID NO: 3).

[0054] Downstream primer (5'-3'): TGGAGGGAGTGAGGCTAATG (as shown in SEQ ID NO: 4).

[0055] The specific detection steps of the kit include:

[0056] 1) Sample treatment, extract DNA from the sample according to the method in Example 1. The sample is the peripheral blood of the test subject.

[0...

Embodiment 3

[0060] Embodiment three: a kind of test kit that is used to detect PID pathogenic mutation that comprises nucleic acid probe

[0061] This example discloses a kit for detecting PID pathogenic mutations, the reagents of the kit include the following several nucleic acid probes:

[0062] 1) 8 nucleic acid probes capable of detecting the c.220T>A mutation on the IL2RG gene, which have an identifiable labeled biotin, and the sequences of the 8 nucleic acid probes are respectively as SEQ ID NO: 5-SEQ ID NO: 12 shows:

[0063] (1) Nucleic acid probe 1 (5'-3'):

[0064] ATCCCCTCCCCCTCGTCCCTTCTCATACCAATAATGCAGAGTGAGGTTGGTAGGCTGGGGCTCAGAGCTGCTGTTCCAAGTGCAATTCAT (shown in SEQ ID NO: 5).

[0065] (2) Nucleic acid probe 2 (5'-3'):

[0066] TCGTCCCTTCTCATACCAATAATGCAGAGTGAGGTTGGTAGGCTGGGGCTCAGAGCTGCTGTTCCAAGTGCAATTCATGTACTCGACATT (shown in SEQ ID NO: 6).

[0067] (3) Nucleic acid probe 3 (5'-3'):

[0068] TCATACCAATAATGCAGAGTGAGGTTGGTAGGCTGGGGCTCAGAGCTGCTGTTCCAAGTGCAATTCATGTACTCGACATT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

This application discloses two new pathogenic mutations related to primary immunodeficiency disease and its application. The above two new pathogenic mutations are specifically: 1) c.220T>A mutation located in IL2RG gene; 2) c.141+3A>T mutation located in CYBB gene. The new pathogenic mutation of PID provided by this application provides a new detectable site for the diagnosis and treatment of the disease; at the same time, the above-mentioned relevant mutation of PID can be detected quickly and effectively by using the kit provided by this application.

Description

technical field [0001] The present invention relates to the field of molecular biomedicine, in particular to the pathogenic mutation of primary immunodeficiency disease and its application, specifically, to the nucleic acid, polypeptide, carrier, recombinant cell and related application related to the disease, and also to an energy A kit for detecting pathogenic mutations in primary immunodeficiency disease. Background technique [0002] Primary immunodeficiency disorder (PID) is a type of disease in which genetic mutations occur in the immune system, leading to defects in immune cells and molecular functions. The clinical manifestations are susceptibility to infection, malignant tumors, allergies, inflammation and autoimmune diseases. Due to the rare disease of PID and the complex clinical phenotype, it is difficult for clinicians to diagnose early, so more patients with severe PID die than in the early years; surviving cases often lead to repeated severe infections and oth...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/12C07K14/715C07K14/80C12N15/63
CPCC07K14/7155C07K14/80C12Q1/6883C12Q2600/156
Inventor 王文婧徐凤萍陈海啸陈艳
Owner SHENZHEN HUADA GENE INST
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More