Pathogenic mutations in primary immunodeficiency diseases and their application
An immunodeficiency disease, primary technology, applied in the field of molecular biomedicine, can solve the problems of variable clinical phenotypes and multiple pathogenic genes
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0023] Example 1: Acquisition of pathogenic mutations
[0024] 1. Sample collection
[0025] The applicant collected 30 patient samples from the Nephrology and Immunology Department of Shenzhen Children's Hospital, specifically the peripheral blood of the patients. All patients signed informed consent, and the project was reviewed and approved by the Huada Gene Ethics Committee.
[0026] Screening criteria: patients have repeated infection, inflammation and other symptoms, after comprehensive analysis of CRP + blood routine (five classifications), humoral immune function test, lymphocyte immune analysis and other test results, it is suspected that the immune function is abnormal.
[0027] 2. Target region capture and high-throughput sequencing
[0028] The applicant searches and consults relevant literature on primary immunodeficiency diseases, and collects information on genes related to immune function, including but not limited to genes that have been confirmed in researc...
Embodiment 2
[0047] Embodiment two: a kind of kit for detecting PID pathogenic mutation comprising primer pair
[0048] This example discloses a kit for detecting PID pathogenic mutations, the reagents of the kit include the following two sets of primer pairs:
[0049] 1) The first set of primer pairs can detect the c.220T>A mutation on the IL2RG gene:
[0050] Upstream primer (5'-3'): AGACTTGCTACCCTCTCTCTTG (as shown in SEQ ID NO: 1).
[0051] Downstream primer (5'-3'): CCTCCTCCTTCTGACCATCATT (shown in SEQ ID NO:2).
[0052] 2) The second set of primer pairs detects the c.141+3A>T mutation on the CYBB gene:
[0053] Upstream primer (5'-3'): GTTTGGCTGGGGTTGAACG (as shown in SEQ ID NO: 3).
[0054] Downstream primer (5'-3'): TGGAGGGAGTGAGGCTAATG (as shown in SEQ ID NO: 4).
[0055] The specific detection steps of the kit include:
[0056] 1) Sample treatment, extract DNA from the sample according to the method in Example 1. The sample is the peripheral blood of the test subject.
[0...
Embodiment 3
[0060] Embodiment three: a kind of test kit that is used to detect PID pathogenic mutation that comprises nucleic acid probe
[0061] This example discloses a kit for detecting PID pathogenic mutations, the reagents of the kit include the following several nucleic acid probes:
[0062] 1) 8 nucleic acid probes capable of detecting the c.220T>A mutation on the IL2RG gene, which have an identifiable labeled biotin, and the sequences of the 8 nucleic acid probes are respectively as SEQ ID NO: 5-SEQ ID NO: 12 shows:
[0063] (1) Nucleic acid probe 1 (5'-3'):
[0064] ATCCCCTCCCCCTCGTCCCTTCTCATACCAATAATGCAGAGTGAGGTTGGTAGGCTGGGGCTCAGAGCTGCTGTTCCAAGTGCAATTCAT (shown in SEQ ID NO: 5).
[0065] (2) Nucleic acid probe 2 (5'-3'):
[0066] TCGTCCCTTCTCATACCAATAATGCAGAGTGAGGTTGGTAGGCTGGGGCTCAGAGCTGCTGTTCCAAGTGCAATTCATGTACTCGACATT (shown in SEQ ID NO: 6).
[0067] (3) Nucleic acid probe 3 (5'-3'):
[0068] TCATACCAATAATGCAGAGTGAGGTTGGTAGGCTGGGGCTCAGAGCTGCTGTTCCAAGTGCAATTCATGTACTCGACATT...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com