Supercharge Your Innovation With Domain-Expert AI Agents!

Primers and kit for detecting tobacco mosaic viruses RT-LAMP

A RT-LAMP, tobacco mosaic virus technology, applied in DNA/RNA fragments, microorganisms, recombinant DNA technology, etc., can solve the problems of low detection sensitivity, expensive instruments, expensive detection instruments, etc., and achieve high detection sensitivity and operation. simple effect

Inactive Publication Date: 2018-12-14
陈定虎
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] At present, the detection methods of plant viruses mainly include biology, serology and molecular biology. The biological method is to use the virus indicator plant to detect the presence or absence of the virus, which generally takes 7-10 days; the serological method is based on the antigen-antibody Generally, it only takes about 4-6 hours to detect the virus, but it requires specific antiserum, and the detection sensitivity is not high, and there are still non-specific problems; molecular biology methods mainly refer to the PCR method. The method is fast and has high accuracy, but it requires expensive detection instruments and related equipment, and for viruses like TMV, since its dilution limit is 10 6 times, that is, to dilute the disease juice to 10 6 Therefore, it is necessary to detect the potential TMV with a very high sensitivity detection method. The sensitivity of the above three methods is difficult to achieve, so there will be a possibility of missed detection, so there is an urgent need to study new detection methods
[0007] At present, the existing detection methods have cumbersome detection steps and expensive instruments, and cannot quickly and conveniently identify the authenticity of shark fins.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primers and kit for detecting tobacco mosaic viruses RT-LAMP
  • Primers and kit for detecting tobacco mosaic viruses RT-LAMP
  • Primers and kit for detecting tobacco mosaic viruses RT-LAMP

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] A kind of primer that tobacco mosaic virus RT-LAMP detects is characterized in that described primer comprises:

[0045] Forward outer primer F3: 5'-TCTACCGTGTGGGTGACA-3';

[0046] Reverse outer primer B3: 5'-GGTCTAATACTGCGTTGTACC-3';

[0047] Forward internal primer FIP:

[0048] 5'-CAATGCTGCGGCCTTCATTTGA-GGTCACATCACGAACACCAG-3';

[0049] Wherein said forward inner primer FIP comprises F1c and F2 sequences:

[0050] F1c: CAATGCTGCGGCCTTCATTTGA;

[0051] F2: GGTCACATCACGAACACCAG;

[0052] Reverse inner primer BIP:

[0053] 5'-TAGACAAATCATGGCACACTTTAGC-GGCATATACGGTTTCTCTGC-3'

[0054] The reverse inner primer BIP includes B1c and B2 sequences:

[0055] B1c: TAGACAAATCATGGCACACTTTTAGC;

[0056] B2: GGCATATACGGTTTCTCTGC.

Embodiment 2

[0058] A kit for detecting tobacco mosaic virus RT-LAMP, characterized in that it comprises:

[0059]

[0060] The primers include:

[0061] Forward outer primer F3: 5'-TCTACCGTGTGGGTGACA-3';

[0062] Reverse outer primer B3: 5'-GGTCTAATACTGCGTTGTACC-3';

[0063] Forward internal primer FIP:

[0064] 5'-CAATGCTGCGGCCTTCATTTGA-GGTCACATCACGAACACCAG-3';

[0065] Wherein said forward inner primer FIP comprises F1c and F2 sequences:

[0066] F1c: CAATGCTGCGGCCTTCATTTGA;

[0067] F2: GGTCACATCACGAACACCAG;

[0068] Reverse inner primer BIP:

[0069] 5'-TAGACAAATCATGGCACACTTTAGC-GGCATATACGGTTTCTCTGC-3'

[0070] The reverse inner primer BIP includes B1c and B2 sequences:

[0071] B1c: TAGACAAATCATGGCACACTTTTAGC;

[0072] B2: GGCATATACGGTTTCTCTGC.

[0073] The product specification of the kit: 60 times.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses primers and kit for detecting tobacco mosaic viruses RT-LAMP. The kit comprises 0.5 milliliters of a RT-LAMP reaction solution buffer, 100 micro-liters of the primers, 60 micro-liters of a fluorescent dye, 60 micro-liters of an enzyme solution, 60 micro-liters of a positive control and 100 milliliters of deionized water. The primers for detecting tobacco mosaic viruses RT-LAMP solve the problems of the existing primers. The kit contains the primers and has the characteristics of rapid detection, high detection sensitivity, simple operation and direct reading of the result.

Description

technical field [0001] The invention relates to a primer for detecting tobacco mosaic virus RT-LAMP, and also relates to a kit containing the primer, which belongs to the field of biotechnology. Background technique [0002] Tobacco mosaic virus, abbreviated as TMV, is an RNA virus that specifically infects plants, especially tobacco and other Solanaceae plants, and is a representative species of the genus Tobamovirus. The virus is Ivanovsky D.I.Iwanowski in 1892 for the first time proved the existence of this TMV. Stanley W.M.Stanley first isolated the TMV virus-like crystals from the squeezed juice of diseased tobacco leaves in 1935. He learned that the protein also contained nucleic acid, and confirmed that the pathogen was the virus. The virus is extremely stable, and because it can proliferate in large quantities in diseased leaves, 2 grams of crystals can be purified from 1 liter of diseased leaf juice. TMV particles are 300 nanometers long and 18 nanometers in diame...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/6844C12N15/11C12R1/94
CPCC12Q1/701C12Q1/6844C12Q2521/107
Inventor 陈定虎杨雷亮管维杨翠云邓丛良王振华
Owner 陈定虎
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More