Unlock instant, AI-driven research and patent intelligence for your innovation.

Kit for detecting human herpesvirus 4

A human herpes virus and kit technology, which is applied in the directions of microorganism-based methods, microorganism determination/inspection, microorganisms, etc., can solve the problems of many missed detections of clinical patients, incomparability, and complicated operation, and achieve convenient detection. Fast, suitable for promotion and application, and the effect of high reference value

Inactive Publication Date: 2018-12-18
AUTOBIO DIAGNOSTICS CO LTD
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the detection of human herpesvirus type 4 mainly uses the traditional enzyme-linked immunosorbent assay, colloidal gold method and chemiluminescence method, which have the problems of long window period, cumbersome operation, false positive and false negative
Due to its high sensitivity, good specificity and easy operation, PCR technology has been more and more widely used in virus detection. At present, a small number of companies have applied PCR technology to the detection of human herpes virus type 4, but due to the quantitative unit of each manufacturer None of them are traceable to the World Health Organization (WHO) standard unit IU / mL, and the sensitivity is very low (400 Copies / mL), resulting in many missed tests of clinical patients, and the quantitative results of various manufacturers are incomparable and have no traceability

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for detecting human herpesvirus 4
  • Kit for detecting human herpesvirus 4
  • Kit for detecting human herpesvirus 4

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1 Preparation of a kit for detecting human herpesvirus type 4

[0041] The composition of kit of the present invention:

[0042] (1) Red blood cell lysate: base solution is H 2 O, 200ul, which contains 0.2M NH4Cl, 0.1mM EDTA and 15mMNaHCO3;

[0043](2) PCR reaction solution 1: base solution is pH8.0 0.1M Tris-HCl, 30ul, including 4pmol / µl primer 1, 4pmol / µl primer 2, 4pmol / µl primer 3, 4 pmol / µl primer 4, 1 pmol / µl probe 1, 1 pmol / µl probe 2, 10UTaq enzyme, 0.1U UNG and 10×PCR reaction buffer, the sequences of the four primers and the two probes are:

[0044] Primer 1: 5'- CATGGGGCAATTGGGCATAC -3' (SEQ ID No.1);

[0045] Primer 2: 5'- AAAGCCGTCGCATGTCTGAT -3' (SEQ ID No.2);

[0046] Primer 3: 5'-TGGAACATATTTGACGGCTTT-3' (SEQ ID No.3);

[0047] Primer 4: 5'-GATCTTAGCTACTACTGCCCAA-3' (SEQ ID No.4);

[0048] Probe 1: FAM-CATGTTGTCACGTCACTCAGCTCC-BHQ1 (SEQ ID No. 5);

[0049] Probe 2: ROX-AAACCCACTGCATCACTCT-BHQ2 (SEQ ID No. 6).

[0050] (3) Reaction solutio...

Embodiment 2

[0058] Example 2 Quantitative detection of human herpesvirus type 4

[0059] The kit prepared in Example 1 is used for quantitative detection of human herpesvirus type 4. The sample to be tested is a human whole blood sample containing 100 copies / ml of human herpesvirus type 4. Of course, it can also be other human herpesvirus types that may contain human herpesvirus type 4. the sample type.

[0060] The specific operation steps are:

[0061] 1. Whole blood pretreatment

[0062] 1) Mix the whole blood sample with the red blood cell lysate at a volume ratio of 1:3;

[0063] 2) After mixing up and down for 10 times, centrifuge at 12000r / min for 5min;

[0064] 3) Remove the supernatant and resuspend the pellet with 1ml of normal saline.

[0065] 2. Template DNA extraction:

[0066] Use a commercial extraction kit to extract template DNA for use in subsequent PCR reactions.

[0067] 1) Add 10ul of magnetic bead suspension to the pre-treated sample to be tested and the strong...

Embodiment 3

[0079] Embodiment 3 Performance testing experiment of the kit of the present invention

[0080] 1. Minimum detection limit experiment

[0081] According to the method of Example 2, 20 samples with the lowest detection limit were detected, and the obtained amplification curve was as follows: figure 2 As shown, the specific data are shown in Table 1 below.

[0082] Table 1

[0083]

[0084] From figure 2 And as can be seen in Table 1, the positive clinical sample of 20 routine 5IU / mL is detected by kit of the present invention, and its result is all positive, proves that the detection limit of kit of the present invention can reach 5IU / mL.

[0085] 2. Quantitative limit detection experiment

[0086] According to the method of embodiment 2, 20 samples of limit of quantification are detected, and the amplification curve obtained is as follows: image 3 As shown, the specific data are shown in Table 2 below.

[0087] Table 2

[0088]

[0089] From image 3 And in ta...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a kit for detecting human herpesvirus 4. The kit comprises two specific primers and one specific probe for detecting human herpesvirus 4, two primers and one specific probe specifically designed according to human genomic beta-globin, a negative control, a positive control and quantitative references A, B, C and D, wherein the sequences of the primers and the probes are asshown in SEQ ID No. 1-6. The kit of the invention has the advantages of convenient and quick detection, capacity of quantitatively detecting human herpesvirus 4 in a short time, high sensitivity, thelowest detection limit of 5 IU / ml (which is equivalent to 100 copies / mL), and good specificity. According to the invention, a pair of primers are designed according to the internal repetitive sequenceBamHIW, so the primers have no cross-interference with other pathogens and have high specificity. The kit of the invention can be traced to the World Health Organization (WHO) standard unit IU / mL; quantitative results have traceability; and the kit has high reference value for clinical diagnosis of related diseases caused by human herpesvirus 4 and is suitable for promotion and application.

Description

technical field [0001] The invention relates to the technical field of virus detection, in particular to a kit for detecting human herpes virus type 4. Background technique [0002] Human herpesvirus type 4, referred to as Epstein-Barr virus, mainly infects the epithelial cells and B lymphocytes of the human oropharynx. The virus infection is not only closely related to infectious mononucleosis in children, familial genetic disease X-linked lymphoproliferative syndrome, EBV virus-associated lymphohistiocytic proliferative hemophagocytic syndrome and chronic active EBV infection, but also It is related to the incidence of about 1% of tumors (gastric cancer, nasopharyngeal cancer, Burkitt tumor, Hodgkin tumor) in the world, and is classified as a first-class carcinogen by the World Health Organization. At present, the detection of human herpesvirus type 4 mainly uses the traditional enzyme-linked immunosorbent assay, colloidal gold method and chemiluminescence method, which h...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/6851C12R1/93
CPCC12Q1/6851C12Q1/705C12Q2600/166C12Q2561/113C12Q2563/107C12Q2531/113
Inventor 安顺王少鑫李振红杜美鲁清月付光宇吴学炜苗拥军
Owner AUTOBIO DIAGNOSTICS CO LTD