Kit for detecting human herpesvirus 4
A human herpes virus and kit technology, which is applied in the directions of microorganism-based methods, microorganism determination/inspection, microorganisms, etc., can solve the problems of many missed detections of clinical patients, incomparability, and complicated operation, and achieve convenient detection. Fast, suitable for promotion and application, and the effect of high reference value
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Example 1 Preparation of a kit for detecting human herpesvirus type 4
[0041] The composition of kit of the present invention:
[0042] (1) Red blood cell lysate: base solution is H 2 O, 200ul, which contains 0.2M NH4Cl, 0.1mM EDTA and 15mMNaHCO3;
[0043](2) PCR reaction solution 1: base solution is pH8.0 0.1M Tris-HCl, 30ul, including 4pmol / µl primer 1, 4pmol / µl primer 2, 4pmol / µl primer 3, 4 pmol / µl primer 4, 1 pmol / µl probe 1, 1 pmol / µl probe 2, 10UTaq enzyme, 0.1U UNG and 10×PCR reaction buffer, the sequences of the four primers and the two probes are:
[0044] Primer 1: 5'- CATGGGGCAATTGGGCATAC -3' (SEQ ID No.1);
[0045] Primer 2: 5'- AAAGCCGTCGCATGTCTGAT -3' (SEQ ID No.2);
[0046] Primer 3: 5'-TGGAACATATTTGACGGCTTT-3' (SEQ ID No.3);
[0047] Primer 4: 5'-GATCTTAGCTACTACTGCCCAA-3' (SEQ ID No.4);
[0048] Probe 1: FAM-CATGTTGTCACGTCACTCAGCTCC-BHQ1 (SEQ ID No. 5);
[0049] Probe 2: ROX-AAACCCACTGCATCACTCT-BHQ2 (SEQ ID No. 6).
[0050] (3) Reaction solutio...
Embodiment 2
[0058] Example 2 Quantitative detection of human herpesvirus type 4
[0059] The kit prepared in Example 1 is used for quantitative detection of human herpesvirus type 4. The sample to be tested is a human whole blood sample containing 100 copies / ml of human herpesvirus type 4. Of course, it can also be other human herpesvirus types that may contain human herpesvirus type 4. the sample type.
[0060] The specific operation steps are:
[0061] 1. Whole blood pretreatment
[0062] 1) Mix the whole blood sample with the red blood cell lysate at a volume ratio of 1:3;
[0063] 2) After mixing up and down for 10 times, centrifuge at 12000r / min for 5min;
[0064] 3) Remove the supernatant and resuspend the pellet with 1ml of normal saline.
[0065] 2. Template DNA extraction:
[0066] Use a commercial extraction kit to extract template DNA for use in subsequent PCR reactions.
[0067] 1) Add 10ul of magnetic bead suspension to the pre-treated sample to be tested and the strong...
Embodiment 3
[0079] Embodiment 3 Performance testing experiment of the kit of the present invention
[0080] 1. Minimum detection limit experiment
[0081] According to the method of Example 2, 20 samples with the lowest detection limit were detected, and the obtained amplification curve was as follows: figure 2 As shown, the specific data are shown in Table 1 below.
[0082] Table 1
[0083]
[0084] From figure 2 And as can be seen in Table 1, the positive clinical sample of 20 routine 5IU / mL is detected by kit of the present invention, and its result is all positive, proves that the detection limit of kit of the present invention can reach 5IU / mL.
[0085] 2. Quantitative limit detection experiment
[0086] According to the method of embodiment 2, 20 samples of limit of quantification are detected, and the amplification curve obtained is as follows: image 3 As shown, the specific data are shown in Table 2 below.
[0087] Table 2
[0088]
[0089] From image 3 And in ta...
PUM
| Property | Measurement | Unit |
|---|---|---|
| diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


