shRNA and vector for knocking down TGF-beta1 (Transforming Growth Factor-beta 1), kit and application of shRNA or vector or kit

A TGF-, kit technology, applied in the field of TGF-β1 knockdown shRNA, carrier, can solve the problem of large organ differences, undisclosed specific mechanism of action, unfavorable diagnosis of neurogenic bladder fibrosis, and development of targeted drugs for treatment, etc. problems, to achieve the effect of inhibiting fibrosis

Active Publication Date: 2018-12-21
XUANWU HOSPITAL OF CAPITAL UNIV OF MEDICAL SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are large differences between different organs and tissues. At the same time, TGF-β1 involves complex signaling pathways, and its downstream effector molecules are numerous. At present, the specific relationship between TGF-β1 and neurogenic bladder fibrosis is still unclear, and its specific role The mechanism has not been revealed, which is not conducive to the diagnosis, treatment and development of targeted drugs for neurogenic bladder fibrosis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • shRNA and vector for knocking down TGF-beta1 (Transforming Growth Factor-beta 1), kit and application of shRNA or vector or kit
  • shRNA and vector for knocking down TGF-beta1 (Transforming Growth Factor-beta 1), kit and application of shRNA or vector or kit
  • shRNA and vector for knocking down TGF-beta1 (Transforming Growth Factor-beta 1), kit and application of shRNA or vector or kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033]The siRNA target was designed, and the primer shRNA was synthesized. The siRNA sequence and the shRNA sequence are shown in Tables 1-2. The primers were annealed to form double-stranded fragments with cohesive ends, the expression vector was digested with restriction endonucleases BamHI and EcoRI, and the digested products were recovered. Interfering fragments were ligated into expression vectors, ligated products were ligated overnight at 16°C, transformed into competent cells DH5α, positive bacteria were picked, and confirmed by sequencing. A large number of lentiviral vector pHBLVTM and auxiliary plasmids pSPAX2 and pMD2G determined by sequencing were extracted, and the virus was packaged and the titer of the virus was determined.

[0034] Table 1 siRNA sequence

[0035] name

sequence

mock siRNA

TTCTCCGAACGTGTCACGTAA (SEQ ID NO: 1)

TGF-β1-siRNA1

ACAATTCCTGGCGTTACCTTGGTAA (SEQ ID NO: 2)

TGF-β1-siRNA2

GCAAAGATAATGTACTCCACGT...

Embodiment 2

[0040] Rats were killed by neck dissection, fresh bladder tissue specimens were cut under sterile conditions, primary rat bladder detrusor cells were isolated and purified, inoculated in 6-well plates, and added or not in the manner described in Table 3 Add the lentivirus and carry out the grouping test. After 48 hours of infection, observe under the fluorescent inverted microscope, the cells infected with the lentiviral vector carrying the GFP gene emit green fluorescence. After 72 hours of infection, observe the expression of green fluorescent protein in the GFP group, judge the transfection efficiency of the virus and take pictures (for specific transfection effects, see figure 1 ), the expression level of TGF-β1 protein in each group of cells was further detected by WB (for specific results, see figure 2 ), the mRNA transcription level of TGF-β1 in the cells of each group was detected by qRT-PCR (for specific results, see image 3 ).

[0041] according to figure 2 The...

Embodiment 3

[0045] Construct neurogenic bladder fibrosis model: After successful isoflurane anesthesia, the rats were fixed on the operating table in the prone position, and the sternum was found by hand as a bony landmark approximately at the level of the forelimbs, and the surgical site was determined. For the burrow towel, cut the back skin longitudinally about 2cm long, bluntly separate the subcutaneous and muscle tissue, and spread it with a spreader to fully expose the T9 spinal cord. Use scissors to cut the spinal cord transversely. The tail moved violently, and then the two stumps were lifted with tweezers, and the spinal canals at the two stumps were visible, which proved that the nerves at this part had been completely severed, and gelatin sponge was filled between the two stumps. After complete hemostasis, the layers are closed sequentially. The animals were put into the recovery room for observation, and then returned to the animal room after waking up. Method of the control ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to shRNA and a vector for knocking down a TGF-beta1 (Transforming Growth Factor-beta 1), a kit and application of the shRNA or the vector or the kit. The shRNA disclosed by the invention comprises two oligonucleotide chains; a sequence of the oligonucleotide chain is as shown in SEQ ID NO:9 to 10. The shRNA, the vector or the kit disclosed by the invention can effectively reduce expression of the TGF-beta1 and inhibit expression of the TGF-beta1, CTGF (Connective Tissue Growth Factor) and alpha-SMA and Smads phosphorylation in detrusor smooth muscle cells or urinary bladder from the mRNA level and the protein level so as to effectively inhibit fibrosis of the detrusor smooth muscle cells or the urinary bladder, and has a treatment effect on fibrosis of neurogenic bladder.

Description

technical field [0001] The present invention relates to the field of gene knockout or knockdown, in particular to a shRNA, carrier, kit and application thereof for knockdown of TGF-β1. Background technique [0002] Neurogenic bladder (neurogenic bladder, NB) refers to bladder and (or) urethral dysfunction caused by damage to the central and (or) peripheral nervous system that regulates voiding function, resulting in bladder fibrosis, small volume, high pressure and upper bladder. Urinary tract hydrops, also known as neurogenic vesico-urethraldysfunction (neuropathic vesico-urethraldysfunction, NVD). Clinically, there are urinary retention, urinary incontinence and other abnormal urination. [0003] Decreased bladder compliance due to increased collagen fibers in the detrusor muscle of neurogenic bladder is the main cause of bladder dysfunction. Current studies have shown that transforming growth factor β1 (trasnforming growth factor-beta 1, TGF-β1) plays an important role ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/867
CPCC12N15/113C12N15/86C12N2310/15C12N2740/15043
Inventor贾春松崔昕欧彤文
OwnerXUANWU HOSPITAL OF CAPITAL UNIV OF MEDICAL SCI