Kit, specific primer and probe for detecting content of escherichia coli, and application

An Escherichia coli, specific technology, applied in the field of postmortem Escherichia coli detection, can solve the problems of impaired intestinal mucosal barrier function, disappearance of function, and high experience requirements.

Inactive Publication Date: 2018-12-21
上海公安学院 +2
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

When the individual dies, the cells begin to degenerate and die, but the bacteria continue to grow, and then the intestinal mucosal barrier function is damaged so that the function disappears, a large number of E. coli are translocated, and some E. coli appear in the blood. There are very few reports on the application of real-time quantitative PCR (qPCR) technology to the detection of DNA content of spoilage bacteria in cadaver samples, and the existing methods for detecting the time of death require relatively high experience of inspectors

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit, specific primer and probe for detecting content of escherichia coli, and application
  • Kit, specific primer and probe for detecting content of escherichia coli, and application
  • Kit, specific primer and probe for detecting content of escherichia coli, and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Embodiment 1 LacZ gene standard product preparation

[0039] To establish a real-time fluorescent quantitative PCR method, the external standard required by the method must first be prepared. The standard should contain highly conserved and specific sequences, and high specificity of the reaction must be ensured. The β-D-galactosidase synthesis gene (LacZ gene) widely exists in Escherichia coli and has high conservation. The present invention uses Escherichia coli LacZ gene as the target sequence. This example mainly uses PCR technology to amplify Escherichia coli LacZ gene, and uses gene recombination technology to connect it to the plasmid vector pMD18-T to construct the recombinant plasmid pMD18-T-LacZ, and carry out corresponding PCR identification and sequencing identification, and finally After quantification, it is used as a standard for the method to be established, laying the foundation for the next method and evaluation.

[0040] 1. Preparation of template D...

Embodiment 2

[0093] Embodiment 2 real-time fluorescent quantitative PCR kit

[0094] 1. Design and synthesis of specific primers and probes

[0095] The present invention carries out bioinformatics comparative analysis to the full sequence of Escherichia coli LacZ gene in the NCBI database, selects the sequence within the conserved fragment sequence suitable for designing primers and probes as the target (see Example 1 for the conserved fragment sequence), and further applies Primer express 3 software, Primer Premier 5 software, and Oligo7.0 software designed multiple sets of real-time fluorescent quantitative PCR primers and probes. After preliminary screening, a set of fluorescent quantitative PCR primers and probes for Escherichia coli was finally determined. .

[0096] The sequence is:

[0097] 5'-CTGGCTCGGATTAGGGCCGCAAGAAAACTATCCCGACCGCCTTACTGCCGCCTGTTTTGACCGCTGGGATCTGCCATTGTCAGACATGTATACCCCGTACGTCTTCCCGAGCGAAAACGGTCTGCGCTGCGGGACGCGCGAATTGAATTATGGC-3'.

[0098] As the core of the p...

Embodiment 3

[0111] Example 3 Quantitative detection of real-time fluorescent quantitative PCR kit to rat heart blood DNA samples after death

[0112] 1. Preparation of heart blood DNA samples after death of rats

[0113] 18 healthy rats, male or female, weighing 180-200g. The indoor environment temperature was controlled at 25°C, and adaptive feeding was performed for 3 days by cervical dislocation. They were randomly divided into 9 groups according to the time of death, with 2 animals in each group, including 1 group of control group (0h after death), and 8 groups of experimental groups (the time of death was: 12h, 24h, 36h, 48h, 60h, 72h, 84h, 96h), placed in a closed room, and 100 μl of heart blood was taken at each time point, and then applied with EZ1 Advanced XL (Promega, USA) according to the instructions of EZ1DNA InvestigatorKit (Promega, USA) Heart blood DNA was extracted and stored at -20°C for later use.

[0114] 2. Determination of the concentration of DNA samples

[0115]...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a group of escherichia coli specific primers and probe sequences so as to establish a fluorescent quantitation PCR detection method which can be applied to detection of the content of escherichia coli in heart blood a dead rat and which is quick, sensitive and good in specificity. According to one side of the invention, specific primers and probes for detecting the escherichia coli are provided, and the specific primers and the probes use conservative fragment sequences as a target goal. A gene clone technique is adopted, escherichia coli LacZ gene specificity fragmentsare inserted into a carrier pMD18-T, so that recombinant plasmids containing LacZ gene specificity fragments are obtained and are used as standard products. A group of specific primers and probes aredesigned and synthesized according to escherichia coli LacZ gene specificity fragment sequences, the PCR reaction condition is optimized, a detection method by using a real-time fluorescent quantitation polymerase chain reaction as a platform is established, and the established method is evaluated.

Description

technical field [0001] The invention belongs to the technical field of molecular biology and in vitro diagnostic reagents, and particularly relates to the detection of Escherichia coli after death. Background technique [0002] β-galactosidase is encoded by the β-galactosidase gene (LacZ gene), which is a tetramer composed of 4 subunits, and generally can catalyze the decomposition of lactose into a molecule of glucose and a molecule of galactose. The protein sequences of β-galactosidase extracted from different species have high homology and similarity. The molecular mass of β-galactosidase is between 100-850ku, among which the molecular mass of β-galactosidase of Escherichia coli is the largest, which is 520-850ku. [0003] Escherichia coli (E.coli) is one of the main bacterial groups of putrefactive bacteria, and it is the most important and most abundant bacteria in the intestinal tract of humans and many animals, accounting for almost 1 / 3 of the dry weight of feces. A...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/689C12Q1/6851C12Q1/10C12Q1/06C12N15/11
CPCC12Q1/6851C12Q1/689C12Q2531/113C12Q2563/107
Inventor安志远周怀谷李发院柳勇赵鹏郭育林夏子芳郑卫国
Owner上海公安学院