Kit, specific primer and probe for detecting content of escherichia coli, and application
An Escherichia coli, specific technology, applied in the field of postmortem Escherichia coli detection, can solve the problems of impaired intestinal mucosal barrier function, disappearance of function, and high experience requirements.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Embodiment 1 LacZ gene standard product preparation
[0039] To establish a real-time fluorescent quantitative PCR method, the external standard required by the method must first be prepared. The standard should contain highly conserved and specific sequences, and high specificity of the reaction must be ensured. The β-D-galactosidase synthesis gene (LacZ gene) widely exists in Escherichia coli and has high conservation. The present invention uses Escherichia coli LacZ gene as the target sequence. This example mainly uses PCR technology to amplify Escherichia coli LacZ gene, and uses gene recombination technology to connect it to the plasmid vector pMD18-T to construct the recombinant plasmid pMD18-T-LacZ, and carry out corresponding PCR identification and sequencing identification, and finally After quantification, it is used as a standard for the method to be established, laying the foundation for the next method and evaluation.
[0040] 1. Preparation of template D...
Embodiment 2
[0093] Embodiment 2 real-time fluorescent quantitative PCR kit
[0094] 1. Design and synthesis of specific primers and probes
[0095] The present invention carries out bioinformatics comparative analysis to the full sequence of Escherichia coli LacZ gene in the NCBI database, selects the sequence within the conserved fragment sequence suitable for designing primers and probes as the target (see Example 1 for the conserved fragment sequence), and further applies Primer express 3 software, Primer Premier 5 software, and Oligo7.0 software designed multiple sets of real-time fluorescent quantitative PCR primers and probes. After preliminary screening, a set of fluorescent quantitative PCR primers and probes for Escherichia coli was finally determined. .
[0096] The sequence is:
[0097] 5'-CTGGCTCGGATTAGGGCCGCAAGAAAACTATCCCGACCGCCTTACTGCCGCCTGTTTTGACCGCTGGGATCTGCCATTGTCAGACATGTATACCCCGTACGTCTTCCCGAGCGAAAACGGTCTGCGCTGCGGGACGCGCGAATTGAATTATGGC-3'.
[0098] As the core of the p...
Embodiment 3
[0111] Example 3 Quantitative detection of real-time fluorescent quantitative PCR kit to rat heart blood DNA samples after death
[0112] 1. Preparation of heart blood DNA samples after death of rats
[0113] 18 healthy rats, male or female, weighing 180-200g. The indoor environment temperature was controlled at 25°C, and adaptive feeding was performed for 3 days by cervical dislocation. They were randomly divided into 9 groups according to the time of death, with 2 animals in each group, including 1 group of control group (0h after death), and 8 groups of experimental groups (the time of death was: 12h, 24h, 36h, 48h, 60h, 72h, 84h, 96h), placed in a closed room, and 100 μl of heart blood was taken at each time point, and then applied with EZ1 Advanced XL (Promega, USA) according to the instructions of EZ1DNA InvestigatorKit (Promega, USA) Heart blood DNA was extracted and stored at -20°C for later use.
[0114] 2. Determination of the concentration of DNA samples
[0115]...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


