A real-time fluorescent quantitative PCR kit for detection of Enterobacter aerogenes
A technology of real-time fluorescence quantification and Enterobacter aerogenes, which is applied in the field of molecular biology and microbial detection, can solve the problem of unfavorable finding of pathogens and achieve good specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
example 1
[0037] The preparation of example 1 Cad gene standard substance
[0038] To establish a real-time fluorescent quantitative PCR method, the external standard required by the method must first be prepared. The standard should contain highly conserved and specific sequences, and high specificity of the reaction must be ensured. The gene widely exists in Enterobacter aerogenes and is highly conserved. In this study, the Cad gene of Enterobacter aerogenes was used as the target sequence. This part mainly uses PCR technology to amplify the Cad gene of Enterobacter aerogenes, and uses gene recombination technology to connect it to the plasmid vector pMD18-T to construct the recombinant plasmid pMD18-T-Cad, and carry out corresponding PCR identification and sequencing identification, Finally, it is quantified as a standard for the method to be established, laying the foundation for the next method and evaluation.
[0039] 1. Preparation of template DNA
[0040] Genomic DNA of Enterob...
example 2
[0111] Example 2 Preliminary establishment of real-time fluorescent quantitative PCR detection method for Enterobacter aerogenes
[0112] 1. Design and synthesis of specific primers and probes
[0113] Taking the conserved fragment of the Cad gene of Enterobacter aerogenes selected above as the target, a set of real-time fluorescent quantitative PCR primers and probes were designed using Primer express 3 software, PrimerPremier 5 software and Oligo 7 software.
[0114] As the core of the present invention, a group of primers and probe nucleotide sequences for real-time fluorescent PCR detection of Enterobacter aerogenes are as follows:
[0115] Upstream primer: Cad-225F 5'- CGCTGTACGCTTCATCTATT -3'
[0116] Downstream primer: Cad-346R 5'- GACGCTGTATGCCGAGGTT -3'
[0117] Probe: Cad225-346 5'-TTCCCTTTGCCTAACATATCTACCGTTT-3'
[0118] The primers and probes amplify the target nucleotide sequence as:
[0119] 5'-CGCTGTACGCTTCATTCTATTTTCCCTTTGCCTAACATATCTACCGTTTTTTATCTGGTAGAAAA...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


