Application of OsBICs gene in regulating plant height and flowering time of plant
A technology of flowering time and genes, applied in the field of plant genetic engineering
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Embodiment 1 Construction of rice OsBICs gene overexpression vector
[0036] (1) Take the seeds of rice Nipponbare, plant them in soil containing nutrients, and grow them under short-day sunshine for 15 days. The penultimate leaf of rice was taken to extract RNA.
[0037] (2) Reverse transcription synthesis of the first strand of cDNA
[0038] (3) Using the designed OsBICs cDNA amplification primers, the reverse transcription product was used as a template for PCR amplification. The primer sequences are as follows (5'-3'):
[0039] pOsBIC1-F:TCTGCACTAGGTACCTGCAGATGGCGACTTCCGGCGACGTC
[0040] pOsBIC1-R:ATGGATCCGTCGACCTGCAGGTAATCAAGCTCGATAATCA
[0041] pOsBIC2-F:TCTGCACTAGGTACCTGCAGATGTGCAAGAGGAGCTGCATG
[0042] pOsBIC2-R:ATGGATCCGTCGACCTGCAGAGAGCAGCCGTTCTGCACCCG
[0043] The PCR reaction system is as follows:
[0044]
[0045] (4) PCR product recovery and product connection
[0046] An agarose gel recovery kit (purchased from Axygen) recovered the PCR products, ...
Embodiment 2
[0057] The acquisition of embodiment 2 transgenic rice plants
[0058] The constructed plasmids containing OsBIC1 cDNA and OsBIC2 cDNA were respectively transformed into Agrobacterium, and rice was transformed.
[0059] 1. Preparation and transformation of Agrobacterium competent
[0060] (1) Preparation of Competent Agrobacterium
[0061] Single colonies of Agrobacterium EHA105 were picked and placed in 5 ml of LB liquid medium containing corresponding antibiotics. The resistance of EHA105 was: 100 μg / ml rifampicin (Rif). Cultivate overnight at 28°C; take 500 μl of the overnight culture and inoculate it into 50ml LB liquid medium containing the corresponding antibiotics, cultivate at 28°C until the OD 600 is about 0.5; place on ice for 30 minutes; centrifuge at 5,000 rpm for 10 minutes at 4°C, and pre- Cold 10mM CaCl 2 Resuspend Agrobacterium cells, centrifuge at 5,000rpm for 10min at 4°C; use 2ml pre-cooled 10mM CaCl 2 Resuspend the pellet, aliquot 100 μl / tube on ice, fr...
Embodiment 3
[0092] Embodiment 3 transgenic rice phenotype identification
[0093] 1. Flowering identification of transgenic rice
[0094] In June 2017, the transgenic rice was planted under natural conditions in the Beijing base, and the flowering phenotype was observed; the transgenic rice was planted in a long-day incubator (14 hours of light, temperature 28°C; 10 hours of darkness, temperature 24°C), and flowering was observed Phenotype: The transgenic rice was planted in a short-day incubator (light for 10 hours, temperature 28°C; dark for 14 hours, temperature 24°C) to observe the flowering phenotype.
[0095] 2. Identification of transgenic rice leaf sheath length
[0096] The transgenic rice was planted in dark, red light, far-red light, and blue light incubators respectively, and the length of the leaf sheath was measured when it grew to 14 days. Experimental results such as figure 2 and image 3 as shown, figure 2 Delayed flowering phenotype in transgenic plants after over...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


