Application of OsBICs gene in regulating plant height and flowering time of plant

A technology of flowering time and genes, applied in the field of plant genetic engineering

Active Publication Date: 2018-12-28
INST OF CROP SCI CHINESE ACAD OF AGRI SCI
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Overexpression of AtBIC1 and AtBIC2 causes delayed flowering and blue-light-specific hypocotyl elongation in Arabidopsis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of OsBICs gene in regulating plant height and flowering time of plant
  • Application of OsBICs gene in regulating plant height and flowering time of plant
  • Application of OsBICs gene in regulating plant height and flowering time of plant

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Embodiment 1 Construction of rice OsBICs gene overexpression vector

[0036] (1) Take the seeds of rice Nipponbare, plant them in soil containing nutrients, and grow them under short-day sunshine for 15 days. The penultimate leaf of rice was taken to extract RNA.

[0037] (2) Reverse transcription synthesis of the first strand of cDNA

[0038] (3) Using the designed OsBICs cDNA amplification primers, the reverse transcription product was used as a template for PCR amplification. The primer sequences are as follows (5'-3'):

[0039] pOsBIC1-F:TCTGCACTAGGTACCTGCAGATGGCGACTTCCGGCGACGTC

[0040] pOsBIC1-R:ATGGATCCGTCGACCTGCAGGTAATCAAGCTCGATAATCA

[0041] pOsBIC2-F:TCTGCACTAGGTACCTGCAGATGTGCAAGAGGAGCTGCATG

[0042] pOsBIC2-R:ATGGATCCGTCGACCTGCAGAGAGCAGCCGTTCTGCACCCG

[0043] The PCR reaction system is as follows:

[0044]

[0045] (4) PCR product recovery and product connection

[0046] An agarose gel recovery kit (purchased from Axygen) recovered the PCR products, ...

Embodiment 2

[0057] The acquisition of embodiment 2 transgenic rice plants

[0058] The constructed plasmids containing OsBIC1 cDNA and OsBIC2 cDNA were respectively transformed into Agrobacterium, and rice was transformed.

[0059] 1. Preparation and transformation of Agrobacterium competent

[0060] (1) Preparation of Competent Agrobacterium

[0061] Single colonies of Agrobacterium EHA105 were picked and placed in 5 ml of LB liquid medium containing corresponding antibiotics. The resistance of EHA105 was: 100 μg / ml rifampicin (Rif). Cultivate overnight at 28°C; take 500 μl of the overnight culture and inoculate it into 50ml LB liquid medium containing the corresponding antibiotics, cultivate at 28°C until the OD 600 is about 0.5; place on ice for 30 minutes; centrifuge at 5,000 rpm for 10 minutes at 4°C, and pre- Cold 10mM CaCl 2 Resuspend Agrobacterium cells, centrifuge at 5,000rpm for 10min at 4°C; use 2ml pre-cooled 10mM CaCl 2 Resuspend the pellet, aliquot 100 μl / tube on ice, fr...

Embodiment 3

[0092] Embodiment 3 transgenic rice phenotype identification

[0093] 1. Flowering identification of transgenic rice

[0094] In June 2017, the transgenic rice was planted under natural conditions in the Beijing base, and the flowering phenotype was observed; the transgenic rice was planted in a long-day incubator (14 hours of light, temperature 28°C; 10 hours of darkness, temperature 24°C), and flowering was observed Phenotype: The transgenic rice was planted in a short-day incubator (light for 10 hours, temperature 28°C; dark for 14 hours, temperature 24°C) to observe the flowering phenotype.

[0095] 2. Identification of transgenic rice leaf sheath length

[0096] The transgenic rice was planted in dark, red light, far-red light, and blue light incubators respectively, and the length of the leaf sheath was measured when it grew to 14 days. Experimental results such as figure 2 and image 3 as shown, figure 2 Delayed flowering phenotype in transgenic plants after over...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of an OsBICs gene in regulating plant height and flowering time of a plant. The OsBICs gene comprises rice genes OsBIC1 and OsBIC2. Amino acid sequences of encodedproteins of the rice genes OsBIC1 and OsBIC2 are correspondingly as shown in SEQ ID NO. 2 and 4. The application of the OsBICs gene in regulating the plant height and the flowering time of the plant,disclosed by the invention, has the advantages that the rice genes OsBIC1 and OsBIC2 are obtained through the first time of cloning, functions of the rice genes OsBIC1 and OsBIC2 are researched, it isfound that effects of the OsBIC1 and the OsBIC2 in the rice photoperiodic reaction are obvious; characteristics of the OsBIC1 and the OsBIC2 are similar to those of arabidopsis thaliana BICs; and theOsBIC1 and the OsBIC2 can both delay flowering and blue light specificity to promote the elongation of a leaf sheath.

Description

technical field [0001] The invention belongs to the technical field of plant genetic engineering, and in particular relates to the application of OsBICs gene in regulating plant height and flowering time. Background technique [0002] Rice is a monocot C3 model plant of Poaceae, and it is an important food crop, accounting for 21% of the world's food production. It is estimated that by 2030, in order to meet the food demand of the growing population, rice production will need to increase by 40% to meet the needs of the population. How to increase the yield per unit area of ​​crops has become an urgent problem for breeders to solve. Therefore, rice has always been the main material for breeding, genetics, and molecular biology research. The traits of rice yield are complex. Flowering (also known as heading date) and plant height are two important agronomic traits of crops, which have become a potential research direction for improving rice yield. The heading date of rice i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/415C12N15/82A01H5/00A01H6/46
CPCC07K14/415C12N15/8261C12N15/827
Inventor刘军李聪赵涛李宏宇刘斌
OwnerINST OF CROP SCI CHINESE ACAD OF AGRI SCI