Application of OsNMCP1 gene in controlling drought tolerance in rice

A rice and genetic technology, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problems of affecting plant growth, restricting plant growth and development, increasing crop production and income, etc.

Inactive Publication Date: 2019-01-01
HUAZHONG AGRI UNIV
View PDF5 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] Plants do not have the ability to move like animals, so when abiotic adversity (such as drought, waterlogging, high temperature, low temperature, saline-alkali, etc.) comes, the growth of plants will be seriously affected, seriously restricting the growth of plants Increased development and crop production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of OsNMCP1 gene in controlling drought tolerance in rice
  • Application of OsNMCP1 gene in controlling drought tolerance in rice
  • Application of OsNMCP1 gene in controlling drought tolerance in rice

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1: Isolation and cloning of the OsNMCP1 gene

[0027] The applicant used the TRIZOL reagent (purchased from Invitrogen Company) to extract total RNA from the leaves of the sequenced rice variety Nipponbare (the original material was from the Institute of Crop Science, Chinese Academy of Agricultural Sciences, which was a routine experimental material) (the extraction method was according to the above-mentioned TRIZOL reagent instruction manual), using Reverse transcriptase SSIII (purchased from Invitrogen) was used to synthesize cDNA by reverse transcription, and the reaction conditions were: 65° C. for 5 minutes, 42° C. for 120 minutes, and 70° C. for 10 minutes. Using this cDNA as a template, the full-length cDNA (2964bp, see the sequence table SEQ ID NO: 2). PCR reaction conditions: pre-denaturation at 95°C for 3min; 35 cycles of 94°C for 30sec, 60°C for 30sec, and 72°C for 3min; extension at 72°C for 10min. The PCR product obtained by amplification was con...

Embodiment 2

[0028] Example 2: Isolation and identification of osnmcp1 mutants

[0029] The T-DNA insertion mutant 1C-01360 (nm1, Hwayoung background) corresponding to the OsNMCP1 gene locus was picked from the Korea Postech Rice Mutant Library (http: / / www.postech.ac.kr). Among them, the flanking sequence of the nm1 mutant 1C-01360 registered in the mutant library of the above website (the sequence length is 1121bp), the sequence is as follows:

[0030] ATCAGCGTACGTGCTTTTGAGTTCAGGCGCACATCTTTATGTAAATAATTTGCATTAGGTCGCTCATCAATGTCATTCGTGCTAGTAGTATTTGTTTGAGTTTGACTAAACTTCAGGTTTTGTTTTAGACGCAGACGACCACTAATGATTTTCCGTCGTGGGGTGCACTAATAGAACGTCTGAACGTTTTCTGCGTGCTTAGACGAGTTCACATTGACCATCAATTTAGTACTAAAAAATTAGCAGAATATTTAGCAGGGTTTGTACTACTTAACTACTTATTGAAATAGAGTTTTATTTGCTATAAATCTTTCGTATTGATCTGTAAAGACAAAATAACATAGTTGTAACAGCGTCCTAATAAATACTTCCTAATCAATTTACCCAAAGTAGGTGGGAATGAAATGGGAAGCTTGGCAAAGGGTAATCAATTTCATGAACAATCATTTTCTGATATAATGAAACAGACATCCTCATTAATCTTCAGTTGAAACAGACATCCTGAAACATGGACCCGACACTGAGAAATTTGGCACGGCCTTACTTA...

Embodiment 3

[0035] Embodiment 3: Construction and transformation of OsNMCP1 gene overexpression vector

[0036] The method for constructing the overexpression vector is as follows: firstly, the positive clone p1301U-OsNMCP1 plasmid obtained in Example 1 was correctly sequenced and then used for transformation. That is, it was introduced into the rice variety ZH11 through the rice genetic transformation system mediated by Agrobacterium, and after pre-cultivation, infection, co-cultivation, screening of hygromycin-resistant calli, differentiation, rooting, seedling training, and transplanting , to obtain transgenic plants. The Agrobacterium-mediated genetic transformation system of rice (japonica subspecies) was reported by Hiei et al. (Hiei et al., Efficient transformation of rice, Oryza sativa L., mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA, Plant J, 6:271-282, 1994) was improved on the basis of. A total of 20 independent transgenic rice plants were ob...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of plant gene engineering, particularly relates to application of OsNMCP1 gene in controlling drought tolerance in rice. According to the invention, a candidate gene screening method is adopted to clone a rice drought-tolerant response gene OsNMCP1 by reverse genetics. The nucleotide sequence of the gene is shown in SEQ NO:1, and the protein sequence encoded by the gene is shown in SEQ NO:3. The phenotypic identification of drought stress at seedling stage and heading stage indicates that overexpression of OsNMCP1 gene causes an improvement of the drought resistance of transgenic rice, while the deletion mutation of OsNMCP1 gene results in a significant decrease of rice drought resistance. In the invention, the biological function of the gene and the pathways and methods of application with the same are demonstrated.

Description

technical field [0001] The invention belongs to the technical field of plant genetic engineering. It specifically relates to the application of OsNMCP1 gene in controlling drought tolerance of rice. The present invention adopts the method of candidate gene screening, through the means of reverse genetics, to clone the rice drought-tolerant response gene OsNMCP1, and the results of drought stress phenotype identification at the seedling stage and adult plant stage show that overexpressing the OsNMCP1 gene can improve the performance of rice in drought environment. The development and growth of the lower root, while the deletion of the OsNMCP1 gene will lead to the growth retardation of the rice root, the development of the cells is hindered, and the root length is shortened, which confirms the function and application of the gene. Background technique [0002] Plants do not have the ability to move like animals, so when abiotic adversity (such as drought, waterlogging, high ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C07K14/415A01H5/00A01H6/46
CPCC07K14/415C12N15/8273
Inventor熊立仲杨君覃永华
OwnerHUAZHONG AGRI UNIV