Preparation method and application of humanized CD40 gene remolding animal model

An animal model, humanized technology, applied in the fields of botanical equipment and methods, biochemical equipment and methods, plant genetic improvement, etc., can solve the genetic instability of transgenes, the uncertainty of insertion copy number, and the low accuracy. question

Active Publication Date: 2019-01-04
BIOCYTOGEN JIANGSU CO LTD +1
View PDF13 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] During the research and development of CD40-target-related drugs, since the amino acid sequence homology between the Cd40 protein of rodents such as mice and human CD40 protein is about 61%, generally speaking, antibodies that recognize human CD40 protein cannot recognize small Mouse Cd40, that is, common rodent models cannot be used to screen and evaluate the efficacy of drugs targeting human CD40 ('t Hart BAetal., Neurodegener Dis.2008; 5(1):38-52)
At present, human-derived tumor xenograft mouse models are widely used to study the efficacy of targeted drugs, but the targeting and specificity of this type of model are not strong in specific target research, and the xenograft mice used It is an immunodeficient mouse, because the main mechanism of agonistic anti-CD40 antibody is to activate host APC, especially dendritic cells, to induce the body's anti-tumor T cell response (Beatty GL, et al.Science2011; 331:1612– 6; Lum HDet al.J LeukocBiol 2006;79:1181–92), so the results of this type of model to study drug efficacy are not high
In addition, there are transgenic ways to transfer the human CD40 gene into mice to establish transgenic mouse models for antibody research, but the mice prepared by transgenic technology have many shortcomings, such as the uncertainty of the insertion site, the insertion copy The uncertainty of the number, the instability of protein expression, and the instability of transgenic inheritance of offspring, resulting in the unrepeatability of experimental data and the loss of genetic inheritance, etc., and cannot be widely used

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method and application of humanized CD40 gene remolding animal model
  • Preparation method and application of humanized CD40 gene remolding animal model
  • Preparation method and application of humanized CD40 gene remolding animal model

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0200] Example 1 Design of Cd40 gene sgRNA

[0201] The target sequence determines the targeting specificity of the sgRNA and the efficiency of inducing Cas9 to cleave the target gene. Therefore, efficient and specific target sequence selection and design are the prerequisites for constructing sgRNA expression vectors.

[0202] Design and synthesize sgRNA sequences that recognize the 5' target site (sgRNA1-sgRNA7) and the 3' target site (sgRNA8-sgRNA14). The 5' target site is located on exon 2 of the Cd40 gene, and the 3' target site is located on exon 7 of the Cd40 gene. The target site sequences of each sgRNA on Cd40 are as follows:

[0203] sgRNA-1 target site sequence (SEQ ID NO: 1): 5'-GACAAACAGTACCTCCACGATGG-3'

[0204]sgRNA-2 target site sequence (SEQ ID NO: 2): 5'-CGGGACAGCTTGGGGTATTCTGG-3'

[0205] sgRNA-3 target site sequence (SEQ ID NO: 3): 5'-ACGTAACACACTGCCCTAGATGG-3'

[0206] sgRNA-4 target site sequence (SEQ ID NO: 4): 5'-GGGTCTTGGTACGGGGCAGGAGG-3'

[0207]...

Embodiment 2

[0217] Example 2 Screening of sgRNA

[0218] UCA kit was used to detect the activities of multiple sgRNAs. The results showed that the sgRNAs had different activities. For the test results, see figure 1 and Table 1. Two of them were selected (sgRNA1 and sgRNA8 respectively) and the upstream and downstream single strands of the sgRNA were synthesized for subsequent experiments. The upstream and downstream single-strand sequences of sgRNA1 and sgRNA8 are as follows:

[0219] sgRNA1 sequence:

[0220] Upstream: 5'-acaaacagtacctccacga-3' (SEQ ID NO: 15)

[0221] Downstream: 5'-tcgtggaggtactgtttgt-3' (SEQ ID NO: 16)

[0222] sgRNA8 sequence:

[0223] Upstream: 5'-catccgggactttaaacc-3' (SEQ ID NO: 17)

[0224] Downstream: 5'-ggtttaaagtcccggatg-3' (SEQ ID NO: 18)

[0225] Table 1 sgRNA activity detection results

[0226]

Embodiment 3

[0227] Example 3 pT7-sgRNA G2 plasmid construction

[0228] Source of pT7-sgRNA G2 plasmid: pT7-sgRNA G2 vector map, see figure 2 . The plasmid backbone is from Takara, Cat. No. 3299.

[0229] The fragment DNA (SEQ ID NO: 19) containing the T7 promoter and sgRNA scaffold was synthesized by a plasmid synthesis company and ligated to the backbone vector by restriction enzyme digestion (EcoRI and BamHI). It was verified by sequencing by a professional sequencing company, and the results showed that the target plasmid was obtained.

[0230] Fragment DNA containing T7 promoter and sgRNA scaffold (SEQ ID NO: 19):

[0231] gaattctaatacgactcactataggggtcttcgagaagacctgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttaaaggatcc

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a preparation method and application of a humanized CD40 gene remolding animal model. The invention also provides a sgRNA sequence capable of specifically targeting the CD40 gene, a method for preparing a multi-gene humanized animal model and related applications. According to the invention, a tool mouse suitable for transplantation of a humanized cell or tissue and a preparation method of a novel humanized animal model are provided, a research of related diseases is facilitated and an effective technical means is provided for the development of biomedical experiments.The invention also relates to remolding an non-human animal by using a humanized gene, in particular to remolding a rodent by using the gene. Particularly, remolding a mouse by using the gene relatesto the preparation method of the humanized CD40 gene remolding animal model and the application thereof in the field of biomedicine.

Description

technical field [0001] This application relates to the establishment method and application of a humanized genetically modified animal model, in particular, to a construction method based on a humanized CD40 genetically modified animal model and its application in biomedicine. Background technique [0002] Experimental animal disease models are indispensable research tools for the study of the etiology and pathogenesis of human diseases, the development of prevention technologies and the development of drugs. However, due to the differences in the physiological structure and metabolic system between animals and humans, traditional animal models cannot well reflect the real conditions of the human body. It is an urgent need for the biomedical industry to establish disease models in animals that are closer to the physiological characteristics of humans . [0003] With the continuous development and maturity of genetic engineering technology, it has been realized to replace or...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/90C12N15/85C12N15/113C12N5/10C12N15/12C12N15/62C07K19/00A01K67/027
CPCA01K67/0278C12N9/22C12N15/113C12N15/8509C12N15/907C07K14/70578A01K2217/072A01K2227/105A01K2267/03C07K2319/00C07K2319/03C12N2310/10C12N2810/10C12N2800/107A01K2267/0387A01K2207/15C12N15/1138C12N2310/20
Inventor沈月雷郭朝设黄蕤赵磊郭雅南白阳张美玲姚佳维
OwnerBIOCYTOGEN JIANGSU CO LTD