Application of miR-71-5p in pest control
A technology of insects, insecticides, applied in applications, insecticides, animal repellants, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] 1. Prediction of miRNA targeting Spodoptera litura and Nrf2
[0035] Combining the results of transcriptome and small RNA sequencing, four websites including TargetScan, RNA22, RNAhybrid and PITA were used to predict miRNAs that may target SlNrf2, and the intersection miRNAs of the prediction results of the four websites were selected. The results indicated that miR-71-5p might target the 3' end of SlNrf2, and the predicted free energy of miR-71-5p binding to SlNrf2 was -21.4 kcal / mol. figure 1 Sequence comparison of miR-71-5p in different insects. The miR-71-5p sequence of Spodoptera litura is: 5'UGAAAGACAGGAGUAGUGAGAUG'3 (SEQ ID No: 1).
[0036] Check our Spodoptera litura midgut sequencing database and the results are shown in Table 1.
[0037] Table 1 Expression of miRNAs in the midgut of Spodoptera litura eating mustard greens
[0038]
[0039] The results in Table 1 showed that the expression level of miR-71-5p was down-regulated in the midgut of Spodoptera ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com