Supercharge Your Innovation With Domain-Expert AI Agents!

Application of miR-71-5p in pest control

A technology of insects, insecticides, applied in applications, insecticides, animal repellants, etc.

Active Publication Date: 2019-01-25
SOUTH CHINA NORMAL UNIVERSITY
View PDF3 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In insects, there are no reports of miRNAs acting on Nrf2

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of miR-71-5p in pest control
  • Application of miR-71-5p in pest control
  • Application of miR-71-5p in pest control

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] 1. Prediction of miRNA targeting Spodoptera litura and Nrf2

[0035] Combining the results of transcriptome and small RNA sequencing, four websites including TargetScan, RNA22, RNAhybrid and PITA were used to predict miRNAs that may target SlNrf2, and the intersection miRNAs of the prediction results of the four websites were selected. The results indicated that miR-71-5p might target the 3' end of SlNrf2, and the predicted free energy of miR-71-5p binding to SlNrf2 was -21.4 kcal / mol. figure 1 Sequence comparison of miR-71-5p in different insects. The miR-71-5p sequence of Spodoptera litura is: 5'UGAAAGACAGGAGUAGUGAGAUG'3 (SEQ ID No: 1).

[0036] Check our Spodoptera litura midgut sequencing database and the results are shown in Table 1.

[0037] Table 1 Expression of miRNAs in the midgut of Spodoptera litura eating mustard greens

[0038]

[0039] The results in Table 1 showed that the expression level of miR-71-5p was down-regulated in the midgut of Spodoptera ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of miR-71-5p in pest control, and belongs to the field of pest control. In the invention, an agricultural pest Spodoptera litura is used to carry out experiments toconfirm that miR-71-5p affects the Spodoptera litura to eat a culture medium for mustard-containing secondary compounds, and the mechanism of action is to inhibit the expression of SlNrf2, thereby affecting a series of Nrf2-regulated downstream genes for secondary compounds in plants. Based on the above experimental results, miR-71-5p can be directly used to control pests that eat plants, or transgenic plants for pest control.

Description

technical field [0001] The invention belongs to the field of pest control, and in particular relates to the application of miR-71-5p in pest control. Background technique [0002] In mammals, it has been reported that a series of transcription factors participate in the regulation of detoxification enzymes and the expression of enzymes in the glutathione metabolic pathway. Among them, NF-E2-related factor 2 (NF-E2-related factor 2, Nrf2) is the most reported transcription factor, and it is a key regulatory factor in biological cell oxidative stress response and resistance to exogenous toxic substances. In the nucleus, Nrf2 can heterodimerize with a class of bZIP transcription factors (MAFF, MAFG, MAFK), bind to the regulatory elements on the promoters of downstream genes, and start the expression of related anti-oxidative stress and detoxification enzyme genes, including γ-glutamic acid synthase in the glutathione metabolic pathway, catalase (CAT), superoxide dismutase (SOD...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A01N57/16A01P7/04
CPCA01N57/16
Inventor 郑思春岑永杰
Owner SOUTH CHINA NORMAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More