Protein capable of regulating macrophage immune functional activity
A technology of macrophages and cells, applied in the field of proteins, can solve the problems that the role of macrophages has not yet been related to research
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Example 1 Construction of PvTrag28 recombinant plasmid
[0031] Prokaryotic expression plasmid pET28a(+), host strain BL21(DE3) and IPTG for induction were purchased from Beijing Quanshijin Biotechnology Co., Ltd.; restriction enzymes, T4 DNA ligase, pfu DNA polymerase and dNTP were purchased from TakaRa Corporation. The synthesis of primers and nucleotide sequence sequencing were completed by Suzhou Jinweizhi Biotechnology Co., Ltd. Agarose affinity medium nickel column (Ni) was purchased from QIAGEN. His-Taq tag antibody was purchased from Cell Signaling Technology Company.
[0032] Design primers to obtain the gene sequence of the Plasmodium vivax PvTrag28 protein by PCR. The primers are as follows: SEQ ID NO.3: GGATCCATGAGATTGTTACTCGCCGTT; SEQ ID NO.4: CTCGAGTTTTTCTAATTCTT TACACCATGA, where GGATCC is the restriction site BamHI of SEQ ID NO.3; CTCGAG It is the enzyme cutting site XhoI of SEQ ID NO.4.
[0033] Using the Plasmodium ovale genome as a template, the m...
Embodiment 2
[0037] Expression of embodiment 2 recombinant protein PvTrag28
[0038] Inoculate 5ml of LB medium containing kanamycin with the positive single clone with correct sequencing, culture overnight at 37°C, inoculate the bacterial liquid into 500ml fresh LB medium containing kanamycin, when OD 600 When it is 0.6-0.8, add 1mmol / L IPTG, induce 8h. The induced PvTrag28 was ultrasonically disrupted and lysed, and the 10% SDS-PAGE electrophoresis analysis showed that the PvTrag28 protein was mainly located in the inclusion body, and the molecular weight was consistent with the expectation.
[0039]Use 8M urea to dissolve inclusion bodies to release PvTrag28 protein, which has a His-tag tag at the carbon terminus. Therefore, the His-tag nickel column of GE Company was used to carry out Ni 2+ Affinity chromatography purification. The protein was purified with different concentrations of imidazole. The concentrations of imidazole were 20mM, 50mM, 100mM, 150mM and 250mM. The protein wash...
Embodiment 3
[0040] Example 3 PvTrag28 protein promotes the polarization of macrophage RAW264.7
[0041] Take RAW264.7 cells in the logarithmic phase, adjust the cell concentration to 5×10 with DMEM medium containing 10% fetal bovine serum (FBS) 5 / mL, inoculated in 6-well plate with 1 mL per well, placed in 5% CO 2 , cultured in a 37°C incubator for 6 hours, discarded the supernatant after the cells adhered to the wall, washed with PBS buffer to remove non-adhered cells. 1 mL of 20 μg / mL PvTrag28 was added to the sample group, and an equal volume of medium was added to the blank group. After continuing to culture for 24 hours, the cells were lysed and centrifuged to obtain the supernatant, and the expression levels of CD80 and PD-L1 were analyzed by Western Blot. The results are attached figure 2 , Western Blot results showed CD80 and PD-L1 protein blot deepened (see attached figure 2 ), that is, the protein expression is up-regulated, indicating that PvTrag28 protein can significan...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More