Unlock instant, AI-driven research and patent intelligence for your innovation.

AID (activation-induced cytidine deaminase) mutant and application thereof

A mutant and carrier technology, applied in the fields of bioengineering and genetic engineering, can solve the problems of small library capacity, long time required for affinity maturation, loss of AID activity, etc., and achieve enhanced mutation ability, fast and efficient antibody affinity maturation, fast and efficient established effect

Active Publication Date: 2019-03-01
INSITUTE OF BIOPHYSICS CHINESE ACADEMY OF SCIENCES
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these systems all have the following defects: 1) The efficiency of cell mutation is not high, resulting in a relatively small library capacity; the low efficiency includes the following two reasons: a. AID can also mutate other cell genes in addition to mutating antibody genes, and cells cannot tolerate Subject to too high level of AID; b. AID can also mutate AID itself. After multiple rounds of amplification, some cells will lose AID activity; 2) It is relatively difficult to obtain stable cells displaying the target antibody, and it takes a long time for affinity maturation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • AID (activation-induced cytidine deaminase) mutant and application thereof
  • AID (activation-induced cytidine deaminase) mutant and application thereof
  • AID (activation-induced cytidine deaminase) mutant and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1AI

[0042] Embodiment 1 AID mutant construction

[0043] The present invention constructs four kinds of AID mutants, AID mutants with NES domain deleted: mouse source mAID-del (SEQ ID NO.5), human source hAID-del (SEQ ID NO.7); NES domain is deleted and contains AID mutant with K10E / T82I / E156G point mutation: mAID-del-K10E / T82I / E156G (abbreviated mAID-plus) (SEQ ID NO.9), hAID-del-K10E / T82I / E156G (abbreviated hAID-plus) (SEQ ID NO. 11). For a schematic diagram of the mutant structure, see figure 1 .

[0044] Wild-type AID: mAID (SEQ ID NO.1), hAID (SEQ ID NO.3) as control.

[0045] 1. Primer design

[0046] According to mAID (SEQ ID NO.2), hAID (SEQ ID NO.4), mAID-del (SEQ ID NO.6), hAID-del (SEQ ID NO.8), mAID-plus (SEQ ID NO.10 ), the nucleotide sequence of hAID-plus (SEQ ID NO.12), use software design PCR amplification primer as follows:

[0047] Primer name

Primer sequence

serial number

HindⅢ-mAID-F

GTACATAAGCTTATGGACAGCCTTCTG

SEQ ID NO.17...

Embodiment 2

[0051] Embodiment 2 Utilizes GFP reporter gene to detect AID mutation efficiency

[0052] The pCDNA3.1(+)-GFPm plasmid was constructed to detect the mutation ability of the non-integrated AID plasmid. The GFP gene of this plasmid contains a stop codon (TAG), GFPm cannot express the complete GFP protein, and normal cells transfected with this plasmid will not produce green fluorescence (see figure 2 ). If the plasmid and the non-integrated AID plasmid are co-transfected into CHO cells, the TAG stop codon in part of the GFPm gene is mutated into a codon encoding an amino acid, thereby expressing the complete GFP protein and making the cell produce green fluorescence. The ratio of fluorescent cells detected by the instrument can indirectly detect the mutation ability of AID.

[0053] Experimental steps:

[0054] 1. Cell culture

[0055] The selected cells of the present invention are CHO cells, cultured using IMDM medium (Hyclone), and its formula is basic medium with 10% fe...

Embodiment 3

[0069] Example 3 Affinity Maturation Evolution of TNF-α Antibody in CHO Cells Using AID Mutants

[0070] 1. Cell culture

[0071] The cells used in this example are CHO-TNF-α cells, which were stored in our laboratory. The Puro fragments present in CHO cells were replaced with anti-TNF-α fragments, and the cells capable of stably expressing anti-TNF-α antibodies were obtained. cells, named CHO-TNF-α. This example is based on CHO-TNF-α cells to mutate antibody fragments and build a library.

[0072] CHO-TNF-α cells that can stably express anti-TNF-α antibodies based on CHO (Chinese hamster ovary cells) cells are cultured in IMDM medium (Hyclone), and its formula is basic medium supplemented with 10% fetal bovine serum (fatal bovine serum, FBS, Hyclone), 100×HT, 4‰ double-antibody (penicillin and streptomycin) with a final concentration of 100U / mL, at 37°C containing 5% CO 2 cultured in a humidified incubator.

[0073] 2. Cell transfection

[0074] The basic process of lipo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an AID mutant for mammalian cellular protein (in particular antibody) screening and engineering modification / evolution and application thereof. The AID mutant has evidently enhanced mutating capacity in CHO (Chinese hamster ovary) cells; AID can provide more antibody mutants of richer mutant types than wild AID; survival rate of CHO cells is unaffected; an antibody mutant base can be constructed quickly and efficiently, and maturation of antibody affinity can be accelerated.

Description

technical field [0001] The invention belongs to the fields of genetic engineering and bioengineering, and in particular relates to an AID enzyme mutant and application thereof. Background technique [0002] In the past 20 years, the development and clinical application of protein, peptide and antibody drugs have made great progress. One of the key technologies driving the development of therapeutic antibodies and proteins is the affinity maturation of antibodies. The technologies currently used for antibody screening and affinity optimization include ribosome display, phage display, yeast display, bacterial display, and mammalian cell display. The basic processes of antibody evolution in phage display, bacterial display and yeast display systems are as follows: 1) Obtain antibody mutations by using error-prone PCR, DNA shuffling, staggered extension, random in vitro recombination, etc.; 2) Construct antibody plasmids by enzyme digestion and ligation library, transfect corr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/78C12N15/55C12N15/85C12N5/10C12N1/21G01N33/573
CPCC12N5/0682C12N9/78C12N15/85C12N2510/02C12Y305/04001G01N33/573G01N2333/978
Inventor 杭海英罗蕊琪赵云
Owner INSITUTE OF BIOPHYSICS CHINESE ACADEMY OF SCIENCES