Ad4/Ad7 type bivalent recombinant adenovirus and application thereof
A technology of recombinant adenovirus and adenovirus, applied in the direction of double-stranded DNA virus, application, virus, etc., can solve the problem of no adenovirus vaccine and so on
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Embodiment 1, the preparation of recombinant adenovirus
[0033]1. Construction of recombinant plasmids
[0034] The recombinant plasmid pBRAd4-Ad7E3 is a circular plasmid, which consists of the following three segments from upstream to downstream: the segment shown in sequence 1 of the sequence listing, the genomic DNA of the recombinant adenovirus and the segment shown in sequence 2 of the sequence listing .
[0035] Compared with the wild-type adenovirus DNA (GenBank: AY594253.1, linear VRL 03-FEB-2005), the genomic DNA of the recombinant adenovirus has only the following three mutations (the positions refer to the positions of the wild-type adenovirus) : ① the 1st to 8th nucleotides were mutated from "ctatctat" to "CATCATCA"; ② the 35983-35990th nucleotides were mutated from "atagatag" to "TGATGATG"; Hexon fifth hypervariable region) replaced "gacagcaaaactattgttgctaactacgatccagatattgtaatgtacacagaaaat" (encoding fifth hypervariable region of adenovirus type 4 hexon...
Embodiment 2
[0050] Embodiment 2, Morphology observation of recombinant adenovirus
[0051] Cultivate A549 cells until the degree of confluence reaches 80% to 90%, then infect the P5 generation virus liquid of Ad4-Ad7E3 recombinant adenovirus prepared in Example 1 or the P5 generation virus liquid of Ad4 adenovirus, MOI=1, and cultivate at 37°C until CPE After reaching 80%, the cells at the bottom of the dish were scraped, transferred to a centrifuge tube, centrifuged at 1000rpm at room temperature for 10min, the supernatant was discarded, the precipitate was washed with PBS buffer, then fixed with 3% glutaraldehyde solution at 4°C for 3h, and then ultra- Thin section and electron microscope ultramicroscopic observation.
[0052] see photos Figure 4 . The Ad4-Ad7E3 recombinant adenovirus particles are arranged in a honeycomb shape with a uniform size, which is similar to that of the wild-type Ad4 adenovirus.
Embodiment 3
[0053] Example 3, Cell Immunofluorescence Experiment of Ad7E3 Epitope of Recombinant Adenovirus Ad4-Ad7E3
[0054] The tested virus fluids were the P5 virus fluids of the Ad4-Ad7E3 recombinant adenovirus prepared in Example 1, the P5 virus fluids of the Ad4 adenovirus, and the P5 virus fluids of the Ad7 adenovirus.
[0055] 1. Take a 24-well plate, put an alcohol-sterilized coverslip into each well before plating, and add 500 μL of A549 cell suspension (containing 1×10 4 cells), and the cells adhered to the wall overnight.
[0056] 2. After completing step 1, take the 24-well plate, and add 10 μL of the test virus solution (containing 10 3 PFU virus), placed at 37°C 5% CO 2 Observe and cultivate in the incubator for 2-3 days until the cells appear mild lesions.
[0057] 3. After completing step 2, discard the supernatant, add 100% pre-cooled methanol, fix the cover slip for 15 min, and then wash with PBS buffer 3 times (5 min each time).
[0058] 4. After completing step 3...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



