Supercharge Your Innovation With Domain-Expert AI Agents!

A kind of construction method and application of recombinant bacteria producing chitosanase

A technology for producing chitosanase and a construction method, which is applied in the field of construction of recombinant bacteria and can solve problems such as increased energy consumption and cost

Active Publication Date: 2021-12-07
CHINA AGRI UNIV
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the substrate concentration reported by Chen et al. is 10%, it requires more than 24 hours of hydrolysis, which greatly increases energy consumption and cost (Chen et al. Biotechnology Letters, 2012, 34:689-694)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of construction method and application of recombinant bacteria producing chitosanase
  • A kind of construction method and application of recombinant bacteria producing chitosanase
  • A kind of construction method and application of recombinant bacteria producing chitosanase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0066] Embodiment 1, the preparation of recombinant bacteria GS115 / BsCsn46 / VHb

[0067] 1. Using the Bacillus subtilis WY-34 genome as a template, PCR amplification was performed using primers BsCsn46-F and BsCsn46-R to obtain the Bacillus subtilis chitosanase gene BsCsn46. The primer sequences are as follows:

[0068] BsCsn46-F: AACCG GAATTC ATGGGACTGAATAAAGATCAAAAGC (the underline is the EcoRI restriction site);

[0069] BsCsn46-R:AAGAAT GCGGCCGC TTATTTGATTACAAAATTACCGTAC (the underline is the NotⅠ restriction site).

[0070] The Bacillus subtilis chitosanase gene BsCsn46 was codon-optimized, and the optimized BsCsn46 gene sequence was shown in Sequence 1, and using the codon-optimized sequence as a template, primers BsCsn46-F and BsCsn46-R were used for PCR amplification. increase to obtain PCR products.

[0071] 2. The PCR product obtained in step 1 and pPICZA were digested with EcoRI and NotI respectively, and ligated with T4 DNA ligase at 16°C to construct the rec...

Embodiment 2

[0081] Embodiment 2, preparation and purification of recombinant chitosanase (BsCsn46)

[0082] 1. Preparation of recombinant chitosanase (BsCsn46) by high-density fermentation of recombinant bacteria

[0083] The high-density fermentation of the recombinant bacteria and the medium refer to the method in the Pichia Fermentation Process Guideline (Invitrogen), and the specific steps are as follows:

[0084] 1. Inoculate the recombinant bacterium that produces chitosanase activity higher (415U / mL) obtained by screening in Example 1 to 150mLYPD medium (tryptone 20g / L, yeast extract 10g / L, glucose 20g / L) , 30°C, 200rpm to OD 600 About 10, as a seed solution.

[0085] 2. Select a 5L fermenter (with a working volume of 1.5L) as a high-density fermentation vessel, add 150 mL of the seed liquid obtained in step 1 into a fermenter containing 1350 mL of fermentation medium for batch fermentation. During the fermentation process, 28% ammonia water was used to adjust the pH to 4.0, the...

Embodiment 3

[0102] Embodiment 3, the enzymatic property determination of recombinant chitosanase BsCsn46

[0103] 1. Determination of optimum pH and pH stability

[0104] Determination of optimum pH: use the purified chitosanase solution obtained in Example 2 as the enzyme solution to be tested, and determine the optimum pH within the pH range of 3.5-7.5. Enzyme activity was determined according to the standard method in Example 2. Taking the highest value of enzyme activity as 100%, the relative enzyme activities under different pH conditions were calculated respectively.

[0105] Determination of pH stability: Dilute the enzyme solution to be tested with different buffer solutions within the pH range of 3.0-11.0, incubate at 45°C for 30 minutes, immediately cool in an ice-water bath for 30 minutes, and then determine the residual enzyme under the optimal conditions according to the standard method vitality. With the enzyme solution without the above treatment (the above treatment ref...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a construction method and application of a recombinant bacterium producing chitosanase. The invention co-expresses the Bacillus subtilis chitosanase gene and the hyaline hemoglobin gene in Pichia pastoris, and the recombinant strain efficiently prepares the chitosanase through a high-density fermentation strategy. The enzyme activity of the chitosanase prepared by the method is as high as 50000 U / mL, and the protein content is as high as 16.0 mg / mL. The specific enzyme activity of the recombinant enzyme is 4065.7U / mg, the optimum pH is 6.0, and the optimum temperature is 55°C. The enzyme hydrolyzes high-concentration (≥10%) chitosan to prepare chitosan oligosaccharides, the chitosan oligosaccharide yield is greater than 75%, and the main products are disaccharides, trisaccharides and tetrasaccharides. The chitosanase preparation method of the present invention produces enzyme level far higher than the reports of existing documents and patents, and the produced enzyme has excellent hydrolysis characteristics, and has good performance in industrial production of chitosanase and preparation of chitosan oligosaccharides. application value.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a construction method and application of a chitosanase-producing recombinant bacterium. Background technique [0002] Chitosan is a product of partial deacetylation of chitin, a straight-chain natural polysaccharide composed of D-glucosamine and N-acetyl-D-glucosamine randomly linked by β-1,4-glucosidic bonds. Chitosanase (EC3.2.1.132) is an enzyme that specifically hydrolyzes chitosan. It randomly cuts β-1,4-glucosidic bonds from chitosan chains, and the products are chitosan and glucosamine. Based on their sequence homology, chitosanases are classified into glycoside hydrolases (GH) 5, 7, 8, 46, 75 and 80 families (Thadathil et al. Food Chemistry, 2014, 150: 392–399 ). [0003] In recent years, there have been many literatures and patent reports on the production of chitosanase by microorganisms, but most of them have low enzyme production levels and are difficult to be used in i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/81C12N15/56C12N9/42C12N15/31C12P19/14C12P19/26
CPCC07K14/195C12N9/2434C12N15/815C12P19/14C12P19/26
Inventor 江正强马帅杨绍青刘翊昊闫巧娟
Owner CHINA AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More