Primer, probe, method and kit for detecting relative expression of BAALC gene in sample

A relative expression level and sample technology, applied to a method for detecting BAALC genes in samples, primers, probes and kits, can solve the problems of high cost and poor specificity, and achieve simple operation and high accuracy , the effect of improving the experimental efficiency

Inactive Publication Date: 2019-04-19
FUZHOU ADICON CLINICAL LAB INC
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among them, because SYBRGreenI is an unsaturated dye, its specificity is not as good as that of the double-probe hybridization method and the Taqman method, and its specificity must be judged by observing the melting curve; and the cost of the double-probe hybridization method is relatively expensive.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer, probe, method and kit for detecting relative expression of BAALC gene in sample
  • Primer, probe, method and kit for detecting relative expression of BAALC gene in sample
  • Primer, probe, method and kit for detecting relative expression of BAALC gene in sample

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Kits for detecting BAALC gene in samples, including:

[0048] (1) Red blood cell lysate, including 16 μmol / L ammonium chloride, 1 mmol / L potassium bicarbonate and 12.5 μmol / L EDTA.

[0049] (2) RNA extraction reagents, including TRIzol, chloroform, isopropanol, 75% ethanol and RNase-free water.

[0050] (3) RNA reverse transcription reagent, ReverTra Ace qPCR RT Kit kit (TOYOBO company).

[0051] (4) Detection system PCR reaction solution, THNDERBIRD Probe qPCR Mix (2×) (TOYOBO Company). The detection system PCR reaction solution includes the upstream primer BAALC-F, downstream primer BAALC-R and probe BAALC-Probe for detecting the BAALC gene, and the upstream primer ABL-F, downstream primer ABL-R and probe ABL- for detecting the internal reference gene ABL. Probe,

[0052] BAALC-F: AGTCCAAGCAGAAGGGCAGAT;

[0053] BAALC-R: AGGCTCAGAAGGTCCCAACAA;

[0054] BAALC-Probe: FAM-AATTCTACTGAGTCCCTGGCAAGAC-TAMRA.

[0055] ABL-F: GATACGAAGGGAGGGTGTACCA;

[0056] ABL-R: CTCG...

Embodiment 2

[0063] The operation process of the inventive method:

[0064] (1) Extract tissue RNA from blood: Add 1ml of the erythrocyte lysate in Example 1 to a clean 1.5ml centrifuge tube, take 0.5ml of anticoagulated blood and mix well, let stand at room temperature for 10min; centrifuge at 5000rpm for 5min, discard Supernatant, collect the cells at the bottom; add 0.5ml of the erythrocyte lysate in Example 1 again, centrifuge at 5000rpm for 5min, discard the supernatant, and collect the cells at the bottom; add 1ml TRIzol to the cells, pipette repeatedly until the precipitate is completely dissolved, and stand at room temperature 5min; add 0.2ml chloroform, shake evenly; centrifuge at 14000rpm 4°C for 10min, absorb the supernatant layer and transfer to another new centrifuge tube (do not absorb the white middle layer); add an equal volume of isopropanol, mix well up and down, Let stand at room temperature for 10min; centrifuge at 14000rpm at 4°C for 10min, discard the supernatant, add...

Embodiment 3

[0076] Example 3 Positive plasmid detection and sensitivity detection

[0077] When preparing the positive plasmid, the BAALC cDNA was directly synthesized first, and then inserted into the previously selected plasmid plasmid (here, the PUC57-T plasmid is used as an example for illustration), so that the PUC57-T / BAALC positive plasmid can be prepared.

[0078] The prepared PUC57-T / BAALC positive plasmid was serially diluted to obtain a copy number of 10 7 、10 6 、10 5 、10 4 、10 3 、10 2 The positive plasmid of copies / μl, and with the positive plasmid of these different concentrations as template, detect according to embodiment 2, the result is as follows figure 1 shown, among them, in figure 1 The positive plasmid concentration corresponding to each amplification curve in the figure is 10 from left to right 7 、10 6 、10 5 、10 4 、10 3 、10 2 . Depend on figure 1 It can be seen that both BAALC and ABL are line-derived, and the primers and probes of the present inventio...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses oligonucleotides, a method and a kit for detecting a BAALC gene in a sample, upstream and downstream primers and a probe for BAALC are included, and upstream and downstream primers and a probe for an ABL internal reference gene are also included. The method can quickly detect whether the BAALC gene exists in the sample and the expression amount of the BAALC gene. The detection result is accurate and sensitive, and an individualized treatment scheme and disease prognosis judgment can be used for treating human acute myeloid leukemia (AML).

Description

technical field [0001] The invention belongs to the fields of biological science and biotechnology, and in particular relates to a method, primers, probes and kits for detecting BAALC genes in samples. The fluorescent PCR technology is used to detect BAALC in human acute myeloid leukemia (AML) patients. gene expression level. Background technique [0002] Acute myeloid leukemia (AML) is the most common type of leukemia, mainly due to the clonal proliferation of leukemia stem cells, which inhibits the normal hematopoietic function of the bone marrow. The presence of cytogenetic abnormalities at the time of diagnosis of AML is an important basis for predicting the prognosis of the disease. In recent years, molecular genetics has been used to evaluate the prognosis of AML patients, including abnormal expression and mutation of genes. BAALC (Brain And Acute Leukemia, Cytoplasmic) gene is located at 8q22.3, and its expression was first found in neuroectodermal tissue. Tanner e...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/6851C12N15/11
CPCC12Q1/6851C12Q2545/114C12Q2531/113C12Q2561/101
Inventor 王淑一吴鹏飞
Owner FUZHOU ADICON CLINICAL LAB INC
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap