The sgRNA that specifically recognizes the porcine tert site, its coding DNA and its application

A specific identification and site technology, applied in the field of genetic engineering, can solve the problem that the molecular mechanism has not been fully analyzed, and achieve the effect of efficient large fragment knockout and strong specificity

Active Publication Date: 2022-04-26
FOSHAN UNIVERSITY
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Telomere reverse transcriptase (Tert) gene plays an important role in the process of aging, but its molecular mechanism of regulating animal aging has not been fully resolved

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • The sgRNA that specifically recognizes the porcine tert site, its coding DNA and its application
  • The sgRNA that specifically recognizes the porcine tert site, its coding DNA and its application
  • The sgRNA that specifically recognizes the porcine tert site, its coding DNA and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Example 1 Design of sgRNA that specifically recognizes pig Tert site

[0020] According to the first exon sequence in the pig Tert gene sequence, its nucleotide sequence is as shown in SEQ ID NO:5 in the sequence table, design sgRNA; select the sgRNA target for gene knockout according to the PAM sequence, PAM sequence It is NGG, so the target of the sgRNA on the first exon sequence of the Tert gene is (named Tert-ag1): CGCCGCACGAAGGTGGCCAGCGG, and the nucleotide sequence identifying the target in the corresponding sgRNA sequence is shown in the sequence listing as SEQ ID As shown in NO: 1, the DNA sequence encoding the above sequence is shown in SEQ ID NO: 3 in the sequence listing.

[0021] According to the second exon sequence in the porcine Tert gene sequence, its nucleotide sequence is shown in SEQ ID NO: 6 in the sequence table, and the sgRNA is designed; the sgRNA target for gene knockout is selected according to the PAM sequence, and the PAM sequence It is NGG, ...

Embodiment 2

[0022] Example 2 Construction of sgRNA expression vector specifically recognizing pig Tert site

[0023] Purchase CRISPR / Cas9 rapid construction kits VK001-02 and VK001-04 from Weishang Lide Company, connect the Tert-sg1 reference kit instructions in the above Example 1 to the VK001-02 vector, and connect the Tert-sg1 in the above Example 1 -sg2 was connected to the VK001-04 vector according to the instructions, and the next experiment was carried out after it was verified to be correct by sequencing.

Embodiment 3

[0024] Example 3 Verification of the efficiency of sgRNA that specifically recognizes the porcine Tert site

[0025] The Tert-sg1 expression vector and Tert-sg2 expression vector in the above Example 2 were co-transfected into porcine fetal fibroblasts by electroporation, and the cells were divided into two groups, one group was not enriched by flow cytometry, and the other was The group was enriched by flow cytometry, and the cells expressing both red fluorescence and green fluorescence were screened out. After 3 days of culture, the total DNA was extracted, and the Tert gene editing region was amplified. Templates, using the primers shown in Table 1, reacted with the system in Table 2, and the reaction conditions were 95°C for 5min; 95°C for 30s, 59°C for 30s, 72°C for 1min 30s 35×; 72°C for 5min.

[0026] Table 1 Primer sequence list

[0027]

[0028] Table 2 PCR reaction system

[0029]

[0030] The above reaction products were detected by electrophoresis, and the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present disclosure provides sgRNA that specifically recognizes the pig Tert site, wherein the sgRNA is composed of pTert-exon1-sgRNA and pTert-exon2-sgRNA, and the nucleotide sequence responsible for recognizing the target fragment in the pTert-exon1-sgRNA is SEQ ID NO:1; the nucleotide sequence responsible for recognizing the target fragment in the pTert-exon2-sgRNA is SEQ ID NO:2. The sgRNA at the pig Tert site has strong specificity. The sgRNA at the pig Tert site can use the CRISPR / Cas9 gene editing system and the double fluorescence enrichment method, which can efficiently knock out large fragments of the pig Tert gene, and the homozygous efficiency can reach 50%. Functional research provided preliminary technical support.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to sgRNA specifically recognizing pig Tert site, its coding DNA and application. Background technique [0002] Aging is the biggest risk factor for human diseases, and the risks of tumors, diabetes, cardiovascular diseases, and Alzheimer's all increase year by year with age. Telomere reverse transcriptase (Tert) gene plays an important role in the process of aging, but its molecular mechanism of regulating animal aging has not been fully resolved. The physiology and other aspects of pigs are highly similar to humans, making them ideal models for human diseases. If pigs are used as the research object, the Tert gene-edited pig cell model will be prepared by genome editing technology, and the molecular mechanism of Tert gene regulating pig aging phenotype will be revealed, which will provide new ideas for the mechanism elucidation of human aging-related diseases and the d...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/113C12N15/54
CPCC12N9/1276C12N15/113C12Y207/07049
Inventor李奎阮进学徐奎张秀玲裴杨莉李华
OwnerFOSHAN UNIVERSITY