A kind of foot-and-mouth disease virus competition ELISA detection kit
The technology of a foot-and-mouth disease virus and a detection kit, which is applied in the field of immunoassay and corresponding biological substances, can solve problems such as economic loss, impact on the development of animal husbandry, and low fatality rate, and achieve reduced workload, effective and practical detection methods, and improved The effect of sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] The preparation of embodiment 1 monoclonal antibody
[0026] 1.1 Foot-and-mouth disease antigen (A / AKT-Ⅲ strain FMDV inactivated antigen) is kept in the laboratory.
[0027] 1.2 Preparation of immune splenocytes
[0028] Take the purified antigen and mix it well with an equal volume of adjuvant, inject it into the mouse body, each injection dose is 1ml, after the first immunization, second immunization, third immunization and booster immunization, measure the antibody titer in the mouse serum degree, will show sufficient antibody titer (1:10 8 ) (ELISA titer) mice were used as a source of immune splenocytes. The method for measuring antibody titer is ELISA detection method.
[0029] 1.3 Preparation of myeloma cells
[0030] Myeloma cells SP2 / 0 cells were preserved in the laboratory.
[0031] 1.4 Cell Fusion
[0032] 1.4.1 Cell Fusion
[0033] Spleen isolation was performed on mice with sufficient antibody titers in 1.2, and a spleen lymphocyte suspension was prep...
Embodiment 2
[0051] Example 2 Preparation of specific single domain antibody
[0052] A / AKT-Ⅲ strain FMDV inactivated antigen immunized Bactrian camels, isolated peripheral blood lymphocytes, extracted total RNA, synthesized cDNA by RT-PCR, and then used single-domain antibody-specific primers (upstream primer: CTTGGTCTCTGATGTGCAGCTGGTGGAGTC downstream primer: CTCGGATCCTCATGAGGAGACGGTGACCTGG) Three amplifications were performed to obtain the VHH gene. A phage display immune library of single domain antibody against type A foot-and-mouth disease virus was constructed. It was determined that the library capacity was 1.2×10 8 . After four rounds of panning, the sequence of type A FMDV single domain antibody was sequenced and named sdAb-A. After amplification, the target fragment was digested and ligated with pSMK vector to construct pSMK-sdAb-A prokaryotic expression vector, which was transformed into Escherichia coli BL21. Detected by SDS-PAGE, the recombinant sd Ab-A was expressed. Rec...
Embodiment 3 2
[0054] Example 3 Preparation and Labeling of Secondary Antibody
[0055] 3.1 Preparation of polyclonal antibodies
[0056] Select healthy and well-nourished mice as immunization objects. First, carry out basic immunization, inject the virus liquid into the mice and perform high-level immunization after recovery. Perform purification; immunize horses with purified serum, collect serum, and purify secondary antibody IgG.
[0057] 3.2 Labeling prepared horse anti-mouse IgG
[0058] 3.2.1 Prepare 1% chloroauric acid solution with 1g of chloroauric acid, store it in the dark at 4°C, and filter it with a 0.22um filter.
[0059] 3.2.2 Prepare 1% trisodium citrate solution with 1g of trisodium citrate and store at 4°C.
[0060] 3.2.3 Take 100ml of distilled water and heat it to 100°C, boil it, add 1ml of 1% chloroauric acid for about 1 minute, add 1ml of 1% trisodium citrate quickly, and time it for 3 minutes, and lower the temperature for 12 minutes. Cool at room temperature for ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



