SNP marker for identifying germplasm resources of kidney beans and screening method thereof
A screening method, the technology of kidney bean, applied in the field of molecular biology and bioinformatics, can solve the problems of less research
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 24
[0104] Example 2 Application of 47 SNP sites in identification and / or differentiation of kidney bean germplasm resources
[0105] The polymorphisms of the 47 sites obtained after sequencing of the P001 variety are as follows:
[0106]
[0107]
[0108]
[0109] The bases of SNP1-SNP47 are connected in sequence from left to right and top to bottom according to the chromosomal order to form the sequence as follows:
[0110] CGTTAAGGCCGGCCTTTTAAGGCCCCAGCCGGAGCCAACTAACCTTGTAGATCTTTCCTGTCCCTGGAACCGGAGAGCCGGCGATGGCCAAAG
[0111] Compare the sequence of the variety to be tested with the sequence in the established kidney bean information database, focusing on comparing the information on 47 sites. If it is consistent with the sequence of the P-001 variety, it can be judged that the variety to be tested is in the information database. P-001 variety.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



