Unlock instant, AI-driven research and patent intelligence for your innovation.

SNP marker for identifying germplasm resources of kidney beans and screening method thereof

A screening method, the technology of kidney bean, applied in the field of molecular biology and bioinformatics, can solve the problems of less research

Inactive Publication Date: 2019-05-17
SHANDONG CROP GERMPLASM CENT
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, SNP technology is mainly used in the identification of germplasm resources of major crops such as wheat and corn, and there are few studies on the identification of germplasm resources of minor crops.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • SNP marker for identifying germplasm resources of kidney beans and screening method thereof
  • SNP marker for identifying germplasm resources of kidney beans and screening method thereof
  • SNP marker for identifying germplasm resources of kidney beans and screening method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 24

[0104] Example 2 Application of 47 SNP sites in identification and / or differentiation of kidney bean germplasm resources

[0105] The polymorphisms of the 47 sites obtained after sequencing of the P001 variety are as follows:

[0106]

[0107]

[0108]

[0109] The bases of SNP1-SNP47 are connected in sequence from left to right and top to bottom according to the chromosomal order to form the sequence as follows:

[0110] CGTTAAGGCCGGCCTTTTAAGGCCCCAGCCGGAGCCAACTAACCTTGTAGATCTTTCCTGTCCCTGGAACCGGAGAGCCGGCGATGGCCAAAG

[0111] Compare the sequence of the variety to be tested with the sequence in the established kidney bean information database, focusing on comparing the information on 47 sites. If it is consistent with the sequence of the P-001 variety, it can be judged that the variety to be tested is in the information database. P-001 variety.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an SNP marker for identifying germplasm resources of kidney beans and a screening method thereof. 200 parts of germplasm resources of kidney beans are used a research object, aIIB-RAD technology is adopted, and a standard 5'-NNN-3' linker is utilized to be ligated with a digestion label; after library quality control is quantified, double-end sequencing is performed on anIllumina Hiseq Xten platform to select a minimum SNP locus combination suitable for identifying 200 parts of germplasm resources of kidney beans, which provides technical support for the establishmentof a technical system for high-throughput identification of germplasm resources of kidney beans. The number of SNP markers is high, the coverage of genomes is high, the typing operation is simple andhigh in accuracy, and a uniform standard can be formed in different environments. Compared with the SSR, the SNP has more advantages in species authenticity identification and database construction.SNPs are denser and more uniform in the genomes, making it easier to achieve data integration comparisons and higher throughput.

Description

technical field [0001] The invention relates to a SNP marker and a screening method for identification of kidney bean germplasm resources, and relates to the fields of molecular biology and bioinformatics. Background technique [0002] The traditional identification technology of agricultural germplasm resources is mainly based on the identification of field plots, relying on the characteristics of different varieties to distinguish different varieties. This method is time-consuming, labor-intensive, and is easily affected by human factors and environmental and climatic conditions, and the detection results cannot be guaranteed. accuracy and timeliness. The electrophoresis technology that emerged in the 1990s is mainly based on proteins and isozymes, but isozymes and proteins are the products of gene expression, and their inheritance methods are not all co-dominant inheritance, with few polymorphisms. More recent and genetically complex material is difficult to identify. I...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6895C12N15/11G16B20/20G16B30/00
Inventor 颜廷进丁汉凤蒲艳艳李群张文兰田茜戴双邓翠霞
Owner SHANDONG CROP GERMPLASM CENT