Humanized PD-L1 monoclonal antibody and preparation method application thereof

A PD-L1, monoclonal antibody technology, applied in biochemical equipment and methods, botanical equipment and methods, applications, etc., can solve the problems of decreased expression of T cell surface activation markers, decreased antigen affinity, etc., and achieve low immunity. The effect of the originality, the promotion of proliferation, and the enhancement of immune response

Inactive Publication Date: 2019-05-21
ANHUI ANKE BIOTECHNOLOGY (GRP) CO LTD
View PDF6 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Second, CDR-grafted antibodies show reduced affinity for their antigens, requiring in vitro-based affinity maturation to restore affinity in humanized antibodies
Studies have shown that the PD-L1 / B7-1 complex is also a negative signal for T cell activation, and the combination of the two can lead to a decrease in the expression of T cell surface activation markers and inhibit T cell proliferation, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Humanized PD-L1 monoclonal antibody and preparation method application thereof
  • Humanized PD-L1 monoclonal antibody and preparation method application thereof
  • Humanized PD-L1 monoclonal antibody and preparation method application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0083] Example 1: Expression and purification of PD-L1 antigen

[0084] 1.1 Synthesis of PD-L1 gene

[0085] The NCBI database retrieved the gene sequence of PD-L1 (GenBank Accession: AY714881.1), analyzed its nucleotide sequence, and carried out modifications such as decorrelating restriction sites or reducing the stem-loop structure for the nucleotide sequence, and entrusted General Biosystems ( Anhui) Co., Ltd. synthesized the full-length anti-human PD-L1 gene, its nucleotide sequence is shown in SEQ ID NO:7, and its amino acid sequence is shown in SEQ ID NO:8.

[0086] 1.2 Cloning of PD-L1 gene

[0087] 1.2.1 PCR amplification of BamH I-PD-L1-XhoI

[0088] Design the upstream and downstream primers P1 and P2 of the PD-L1 gene:

[0089] P1: AAT GGATCC ACTGGTGACGCATTTACTGTCACGGTTCC (the underline is the restriction site of BamH I)

[0090] P2:AAT CTCGAG TTAGTGGTGGTGGTGGTGGTGACCTCCTCCATTGACTTTCACAGTAATTCGCTTGT (XhoI restriction site is underlined)

[0091] Using the ...

Embodiment 2

[0109] Example 2: Generation of Humanized PD-L1 Rabbit Monoclonal Antibody

[0110] 3.1 Production of PD-L1 rabbit monoclonal antibody

[0111] The recombinant human PD-L1 antigen protein was prepared, and 2 rabbits (No. 6109 and 6110) were selected and immunized by subcutaneous injection. The first injection of 400 μg of antigen and immune adjuvant, the next three injections of 200 μg of antigen and immune adjuvant, the fifth time with 200 μg (No. The cycle is about 3 months.

[0112] After the immunization, the rabbit serum was collected, and the enzyme-linked immunosorbent assay (ELISA) method was used to detect the anti-PD1 / PD-L1 activity of the serum after immunization. Rabbit number 6110 was selected and screened using the SMab platform. In the end, among the 1613 clones, there were 270 ELISA-positive clones with an expression level >100ng / ml, and these clones were subjected to blocking detection, and 13 clones with potential PDL1 inhibitory activity were obtained.

...

Embodiment 3

[0121] Embodiment 3: ELISA assays the blocking activity of rabbit serum

[0122]The rhPD1-mFc antigen was diluted to 1 μg / mL, plated overnight at 4°C, washed 3 times with TPBS, blocked in an oven at 37°C for 1 hour, washed 3 times with TPBS, and then added rabbit sera numbered 6109 and 6110 (3-fold serial dilution with pure serum as the actual concentration) ) and biotin-labeled PD-L1, the PD-L1 antibody was serially diluted 100 μl / well by 3 times from the initial concentration of 8 μg / mL, and eight concentration gradients were diluted in turn, and the concentration of biotin-labeled PD-L1 was 50 ng / mL . Incubate with shaking at room temperature for 1 hour, wash with TPBS three times, add goat anti-human HRP secondary antibody, and incubate with shaking at room temperature for 30 minutes. Wash 3 times with TPBS, add OPD to develop color, and use H 2 SO 4 termination.

[0123] The microplate reader measures the OD490mm absorbance value, and the results are as attached ima...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to the technical field of biomedical engineering, in particular to an anti-PD-L1 humanized rabbit monoclonal antibody, provides a novel humanized rabbit anti-PD-L1 monoclonal antibody, and discloses an amino acid sequence of the humanized rabbit monoclonal antibody, a corresponding expression vector, a host cell capable of expressing the antibody, and a production method of the antibody. Specially, the anti-PD-L1 monoclonal antibody is obtained through humanized transformation after a rabbit is immunized, has high expression quantity in mammalian cells, can be specially bound to PD-L1 protein in an extracellular region, has a significant ability of inhibiting ligand-receptor binding, blocks binding of PD1 and PD-L1, and restores the function of a T cell. The anti-PD-L1 humanized rabbit monoclonal antibody can serve as an immune checkpoint inhibitor, especially for the treatment, prevention or diagnosis of PD-L1 related cases such as the tumor.

Description

technical field [0001] The invention belongs to the technical field of biomedical engineering, and specifically relates to a humanized rabbit PD-L1 monoclonal antibody, its preparation method and application. Background technique [0002] Rabbits are well known to produce a wide variety of antibodies against many antigens, including phosphopeptides, carbohydrates and immunogens that are not immunogenic in mice. Polyclonal antibodies from rabbits have proven useful in the laboratory. However, inconsistent and limited antibody production during immunization hindered its clinical application until rabbit monoclonal antibodies could be produced. At present, two generations of commercialized rabbit monoclonal antibodies have been developed: the first generation is a large-scale production platform of monoclonal antibodies based on hybridoma technology; the second generation is a large-scale production platform based on phage display technology. However, the development of the f...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C07K16/28C12N15/13A61K39/395A61K45/06A61P35/00A61P43/00
Inventor 徐婷杨文静鲍文英叶洪涛崔智强周伟宋玉范清林宋礼华
Owner ANHUI ANKE BIOTECHNOLOGY (GRP) CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap