Humanized PD-L1 monoclonal antibody and preparation method application thereof
A PD-L1, monoclonal antibody technology, applied in biochemical equipment and methods, botanical equipment and methods, applications, etc., can solve the problems of decreased expression of T cell surface activation markers, decreased antigen affinity, etc., and achieve low immunity. The effect of the originality, the promotion of proliferation, and the enhancement of immune response
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0083] Example 1: Expression and purification of PD-L1 antigen
[0084] 1.1 Synthesis of PD-L1 gene
[0085] The NCBI database retrieved the gene sequence of PD-L1 (GenBank Accession: AY714881.1), analyzed its nucleotide sequence, and carried out modifications such as decorrelating restriction sites or reducing the stem-loop structure for the nucleotide sequence, and entrusted General Biosystems ( Anhui) Co., Ltd. synthesized the full-length anti-human PD-L1 gene, its nucleotide sequence is shown in SEQ ID NO:7, and its amino acid sequence is shown in SEQ ID NO:8.
[0086] 1.2 Cloning of PD-L1 gene
[0087] 1.2.1 PCR amplification of BamH I-PD-L1-XhoI
[0088] Design the upstream and downstream primers P1 and P2 of the PD-L1 gene:
[0089] P1: AAT GGATCC ACTGGTGACGCATTTACTGTCACGGTTCC (the underline is the restriction site of BamH I)
[0090] P2:AAT CTCGAG TTAGTGGTGGTGGTGGTGGTGACCTCCTCCATTGACTTTCACAGTAATTCGCTTGT (XhoI restriction site is underlined)
[0091] Using the ...
Embodiment 2
[0109] Example 2: Generation of Humanized PD-L1 Rabbit Monoclonal Antibody
[0110] 3.1 Production of PD-L1 rabbit monoclonal antibody
[0111] The recombinant human PD-L1 antigen protein was prepared, and 2 rabbits (No. 6109 and 6110) were selected and immunized by subcutaneous injection. The first injection of 400 μg of antigen and immune adjuvant, the next three injections of 200 μg of antigen and immune adjuvant, the fifth time with 200 μg (No. The cycle is about 3 months.
[0112] After the immunization, the rabbit serum was collected, and the enzyme-linked immunosorbent assay (ELISA) method was used to detect the anti-PD1 / PD-L1 activity of the serum after immunization. Rabbit number 6110 was selected and screened using the SMab platform. In the end, among the 1613 clones, there were 270 ELISA-positive clones with an expression level >100ng / ml, and these clones were subjected to blocking detection, and 13 clones with potential PDL1 inhibitory activity were obtained.
...
Embodiment 3
[0121] Embodiment 3: ELISA assays the blocking activity of rabbit serum
[0122]The rhPD1-mFc antigen was diluted to 1 μg / mL, plated overnight at 4°C, washed 3 times with TPBS, blocked in an oven at 37°C for 1 hour, washed 3 times with TPBS, and then added rabbit sera numbered 6109 and 6110 (3-fold serial dilution with pure serum as the actual concentration) ) and biotin-labeled PD-L1, the PD-L1 antibody was serially diluted 100 μl / well by 3 times from the initial concentration of 8 μg / mL, and eight concentration gradients were diluted in turn, and the concentration of biotin-labeled PD-L1 was 50 ng / mL . Incubate with shaking at room temperature for 1 hour, wash with TPBS three times, add goat anti-human HRP secondary antibody, and incubate with shaking at room temperature for 30 minutes. Wash 3 times with TPBS, add OPD to develop color, and use H 2 SO 4 termination.
[0123] The microplate reader measures the OD490mm absorbance value, and the results are as attached ima...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap