Unlock instant, AI-driven research and patent intelligence for your innovation.

A nucleic acid aptamer pq-15 specifically binding to paraquat and its application

A nucleic acid aptamer and paraquat technology, which is applied in DNA/RNA fragments, material inspection products, biological testing, etc., can solve the problems that cannot be widely used, and achieve the effect of convenient construction, easy operation, and high sensitivity

Active Publication Date: 2022-02-18
GUIZHOU UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, the main detection methods for paraquat include immunoassay, high performance liquid chromatography, chromatography mass spectrometry, high performance capillary electrophoresis, etc. These detection methods require specific equipment, professional operators and certain operating skills, and cannot be widely used

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A nucleic acid aptamer pq-15 specifically binding to paraquat and its application
  • A nucleic acid aptamer pq-15 specifically binding to paraquat and its application
  • A nucleic acid aptamer pq-15 specifically binding to paraquat and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] 1. In vitro screening steps of nucleic acid aptamers

[0041] (1) Immobilization of random ssDNA library. Take a certain amount of random ssDNA library (5′-ACCGACCGTGCTGGACTCT-N30-AGTATGAGCGAGCGTTGCG-3′), mix it with P3 (5′-Biotin-CGCAACGCTCGC-3′) sequence at a molar ratio of 1:2, and anneal at 95°C for 5 minutes After incubation at 30°C for 60 min, the 12 nucleotide sequences at the 3' end of the random library are complementary to P3 through hydrogen bonds. Transfer the paired mixture into a centrifuge tube containing magnetic beads and incubate at 30°C for 60 min. Since streptavidin is attached to the surface of the magnetic beads, the random library is immobilized on the magnetic beads through the interaction of biotin-avidin. superior. Finally, use Binding Buffer (BB buffer solution, 100mmol / LNaCl; 20mmol / LTris·HCl; 5mmol / LKCl; 2mmol / L MgCl 2 6(H 2 O); 1mmol / L CaCl 2 ; 0.02% Tween-20, pH=7.4) Wash to remove unimmobilized random library and P3.

[0042] (2) El...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a nucleic acid aptamer PQ‑15 specifically binding to paraquat and its application. The nucleic acid aptamer is a single-stranded DNA consisting of 68 nucleotides. The base sequence of the aptamer is It is: 5′‑ACCGACCGTGCTGGACTCTCGCGCAGCGCCGAGT CCGAACTGGGTGGGGAGTATGAGCGAGCGTTGCG‑3′ (68bp); the nucleic acid aptamer PQ‑15 of the present invention can be used as the recognition molecule of paraquat, and the gold nanoparticles aggregated by cationic compounds are used as the sensing signal, and the The new colorimetric detection method of paraquat pesticide based on nucleic acid aptamer recognition has a minimum detection limit of 25.2nmol / L, and other competitive targets have no obvious interference on the detection of paraquat, and the recovery rate of paraquat in actual samples is 91.13 % ~ 99.60%. The advantage of this detection method is that it is easy to construct, fast and can be distinguished by naked eyes, high sensitivity, short time required, low cost and easy to operate. It can be widely used in the rapid detection of paraquat residues in actual samples.

Description

technical field [0001] The invention relates to a nucleic acid aptamer PQ-15 specifically binding to paraquat and its application in the detection of paraquat, which belongs to the cross field of biology and chemistry. Background technique [0002] Nucleic acid aptamer refers to a single oligonucleotide with 10 to 100 bases and a specific complex three-dimensional structure obtained through the screening of Systematic Evolution of Ligands by Exponential Enrichment (SELEX) technology, and can ssDNA or RNA molecules that specifically bind to harmful targets such as metal ions, pesticides, and biotoxins. Nucleic acid aptamers have the recognition characteristics of protein antibodies, a wide range of target molecules, small molecular weight, low immunogenicity, easy chemical synthesis, transformation and labeling and other advantages. In recent years, nucleic acid aptamers have been applied in biomedical fields such as new therapeutic drugs, drug delivery, cancer cell detectio...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/115G01N33/53
Inventor 吴远根冉旭东杨玉霞陶菡
Owner GUIZHOU UNIV