DPO primer pair, detection method and kit of candida classification detection and application of kit of candida classification detection

A DPO primer, Candida technology, applied in biochemical equipment and methods, recombinant DNA technology, microbial determination/inspection, etc. good effect

Inactive Publication Date: 2019-05-28
DYNAMIKER BIOTECH TIANJIN
View PDF11 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this invention cannot distinguish the specific strains corre

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • DPO primer pair, detection method and kit of candida classification detection and application of kit of candida classification detection
  • DPO primer pair, detection method and kit of candida classification detection and application of kit of candida classification detection
  • DPO primer pair, detection method and kit of candida classification detection and application of kit of candida classification detection

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0101] The assembly of embodiment 1 kit

[0102] The nucleotide sequence of the DPO primer is shown in SEQ ID NO.1-2:

[0103] DPO upstream primer sequence (SEQ ID NO.1): 5'-ACAAGGTTTCCGTAGGTGIIIIIGCGGAAGGAT-3';

[0104] DPO downstream primer sequence (SEQ ID NO.2): 5'-TCATATTACGTATCGCIIIIIICTGCGTTCTTC-3'.

[0105] Negative quality control product: the negative quality control is a plasmid containing the Arabidopsis DNA fragment, the nucleotide sequence of the Arabidopsis DNA fragment is shown in SEQ ID NO.3, and the specific sequence is as follows:

[0106] CATGATTCAGCCAACATAACCCGACCCGTACAATTCTATTACGCGTCTCCGGCGACTGACTATACTTGCCGTTCGGAGTTAGGGTTTTACTCCGAGAGAAAATTGAGTCAGCGATGAATCCGTTGACAAGGTGAAGAAGACGCAGAGCATTAACGCGAAAGAATTAGATCTAGGGATTTACGACGAAGCATCTTGGCACGCCAAGTACAAAGATTCAGCCTACGTTTACGTCGGAGAATTACCTTACGATCTCACGGAGGGTGACCTCCTCGCCGTTTTCTCACAATATGGTGAAGTTGTTGATTTGAATCTTGTTCGAGATAAAGGAACTGGGAGATCAAAAAGATTTGCGTTTGTTGCTTATGAAGATCAGAGAAGTACTAATCTTGCTGTTGGATAATAAAAGTGGAGCATTGTGGTAAATA...

Embodiment 2

[0120] Embodiment 2 candida classification detection

[0121] Adopt the kit among the embodiment 1 to carry out Candida classification detection, comprise the steps:

[0122] (1) Sample DNA extraction:

[0123] (2) Preparation system, the specific system composition is shown in Table 1:

[0124] Table 1

[0125] components

dose

Taq Polymerase

2U

dNTP

2M

Primers

200nM

MgCl 2

3mM

Tris-HCl

15mM

KCl

100mM

template

1μL

DMSO

5％

SYBR Green I Dye

1×

Total

25 μL

[0126] (3) Put the system in step (2) into a real-time fluorescent PCR instrument to perform PCR amplification reaction. The specific conditions are as follows:

[0127] (1") Preheat at 50°C for 2 minutes, 1 cycle;

[0128] (2") Pre-denaturation at 95°C for 10 minutes, 1 cycle;

[0129] (3") Denaturation at 95°C for 10s, extension at 58°C for 40s, fluorescence signal collection during extension, 4...

Embodiment 3

[0145] Embodiment 3 specific detection analysis

[0146] Extract Cryptococcus neoformans, Cryptococcus gattii, Aspergillus nidulans, Aspergillus versicolor, Saccharomyces cerevisiae, Penicillium marneffei, Candida albicans, Candida krusei, Candida glabrata, Candida parapsilosis, Candida tropicalis, The DNA of Bordetella pertussis, Haemophilus influenzae, Pseudomonas aeruginosa, Staphylococcus aureus and Streptococcus pneumoniae were detected using the kit of Example 1 of the present invention and the method of Example 2. The results are shown in Table 4.

[0147] Table 4 specificity detection results

[0148]

[0149]

[0150] As can be seen from Table 4, the specificity of the kit of the present invention is good, can effectively distinguish Candida and non-Candida, and non-Candida has no Ct value to show that it cannot be effectively amplified. In addition, for the closest Candida albicans, Candida tropicalis, Candida parapsilosis, Candida krusei and other Candida spe...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a DPO primer pair, detection method and kit of candida classification detection and application of the kit of candida classification detection. Nucleotide sequences of the DPO primer pair are as shown in SEQ ID NO.1-2. The primer pair can specifically amplify candida, and is not crossed with other common pathogenic bacteria such as aspergillus, escherichia coli and staphylococcus aureus, moreover, by designing the DPO primer pair, products of different candida strains have different annealing temperatures, through melting curve analysis of the products, candida albicans,candida tropicalis, candida parapsilosis, candida krusei and candida glabrata can be judged, only one pair of primers are used for achieving multiple detection, and compared with the prior art, the DPO primer pair is more simple, convenient and economic.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a DPO primer pair, a detection method, a kit and its application, in particular to a DPO primer pair, a detection method, a kit and its application for the detection of Candida species, in particular to a DPO primer pairs, detection methods, kits and applications for the detection of Candida albicans, Candida tropicalis, Candida parapsilosis, Candida krusei and Candida glabrata. Background technique [0002] Candida is one of the most common opportunistic pathogens in fungi, mainly including Candida albicans, Candida tropicalis, Candida glabrata, Candida parapsilosis and Candida krusei, which account for 80% of clinical samples. %above. Candida often parasitizes on human skin, oral cavity, vagina, and intestinal mucosa. When the body's immune function declines, it is easy to cause candidiasis. Because the culture method takes a long time to distinguish different Candida species, it i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/6895C12Q1/04C12N15/11
Inventor 王志贤阎香言盛长忠周泽奇粟艳
Owner DYNAMIKER BIOTECH TIANJIN
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap