Unlock instant, AI-driven research and patent intelligence for your innovation.

Recombinant pig alpha-interferon protein and coding gene and application thereof

A technology encoding genes and proteins, applied in the direction of interferon, cytokine/lymphokine/interferon, peptide/protein component, etc., can solve the problem of high antiviral activity, achieve a broad spectrum of antiviral, easy industrial production, purity high effect

Inactive Publication Date: 2019-06-07
北京宝易生物技术有限公司 +1
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The purpose of the present invention is to provide a recombinant porcine α-interferon protein and its coding gene and application, in order to solve the advantages of existing recombinant protein with high antiviral activity, good disease treatment effect and high yield

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant pig alpha-interferon protein and coding gene and application thereof
  • Recombinant pig alpha-interferon protein and coding gene and application thereof
  • Recombinant pig alpha-interferon protein and coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Embodiment 1 Synthesis and protein expression of recombinant porcine alpha-interferon protein gene

[0032] 1. The method for obtaining the target gene of recombinant porcine α-interferon

[0033] Referring to the nucleotide sequence of the recombinant porcine alpha-interferon gene (GENBANK number: NM_215383.1) the nucleotide sequence is shown in sequence 2 (SEQ ID NO.2) in the sequence table, and the primers are designed according to the above gene sequence as follows : Primer upstream sequence (5' CATATGTCCGACGCGCTAACCC 3') primer downstream sequence (5' TTATTCGTTCCGCAGGCGGACC 3') The restriction sites of the two primers are: 5' end plus NdeI restriction site CATATG, 3' end plus Pig blood was collected from the jugular vein of CTCGAG at the XhoI restriction site, and the total RNA of pig blood cells was extracted using the RNA extraction kit from Qiagen. Then perform reverse transcription PCR. In a 20 μL system, the specific sample volume is as follows: 10 μL of tota...

Embodiment 2

[0048] Example 2 Titer Detection of Recombinant Porcine α-Interferon Protein

[0049] Using the CPE inhibition-based inhibition microassay and using the Wish cell / VSV virus system, the reciprocal of the maximum dilutable multiple of interferon per milliliter that can protect half of the cells from virus infection is defined as interferon units, expressed in international units (IU ) and calibrated using national standards. Culture Wish cells with RPMI-1640 medium on a 96-well cell culture plate at a cell density of 350,000 / mL, add 100 μL per well, and place at 37°C, 5% CO 2 incubator for 5 hours. Add recombinant porcine interferon α-interferon at different dilutions, 37°C, 5% CO 2 Incubate for 24 hours. Aspirate the supernatant from each well, inoculate 100 μL of VSV virus suspension at a concentration of 100 CCID50 / mL in each well, and continue culturing for 24 hours. Observing the cell lesions under a microscope, the cells in the control group showed lesions such as shed...

Embodiment 3

[0050] Embodiment 3 Recombinant porcine α-interferon protein clinical trial

[0051] 1. The recombinant porcine α-interferon protein of the embodiment of the present invention treats classical swine fever

[0052] The number of diseased pigs clinically identified as swine fever and swine fever is 2033, which are about piglets and Duroc pigs. The age of pigs is 1-20 months, the age of piglets is 1-16 months, and the age of adult pigs is 1-20 months. More than 16 months, they were divided into 1304 test groups and 729 control groups, wherein the test group used the recombinant porcine α-interferon protein prepared in Example 1 of the present invention. The therapeutic dosage is 100,000 IU / kg for piglets, 200,000 IU / kg for adult pigs, and the control group is the existing one. The statistical results of the clinical symptoms of treating classical swine fever are shown in Table 1.

[0053] Table 1

[0054]

[0055] 2. Recombinant porcine α-interferon protein of the embodimen...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses protein. The protein is selected from the following (a) the protein of which the amino acid sequence is as shown in SEQID NO.1; or (b) the protein derived from the protein in (a), wherein the amino acid sequence of the protein in (b) is obtained through substitution and / or deletion and / or addition of one or several amino acid residues of the amino acid sequence as shown inthe SEQID NO.1, and the protein in (b) has interferon activity. The recombinant protein disclosed by the embodiment of the invention is good in clinical usage effects; and clinical experiment indicates that the recombinant protein has obvious effects on prevention and treatment of diarrhoeal diseases of piggies, and the cure rate can reach 95%. The prepared recombinant pig alpha-interferon proteincan effectively prevent and treat pig infectious diseases caused by various viruses, including hog cholera, piggy diarrhoea, porcine reproductive and respiratory syndromes and the like, is broad-spectrum in antivirus range and can enhance the immunity of animals.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a recombinant porcine α-interferon protein, its encoding gene and application. Background technique [0002] Pork is one of the most important and common meat products. With the economic growth, the improvement of people's living standards and export trade and other factors, the market demand for pork and other pig products has also increased greatly, which has led to the growth of the pig industry. Develop. In the huge development process of the pig industry, there are also many problems, and the outbreak of the disease has become the trouble that causes the biggest loss and harm to the farmers. Pig infectious diseases include foot-and-mouth disease, swine fever, pseudorabies, blue ear disease, etc. These viral swine diseases are highly contagious. Once a pig is infected, it will easily spread to the entire pig farm or even spread to the entire region. The death rate of sick pigs ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/56C12N15/70A61K38/21A61P31/14A61P31/22
Inventor 李振义张秀军王顺山
Owner 北京宝易生物技术有限公司