Recombinant pig alpha-interferon protein and coding gene and application thereof
A technology encoding genes and proteins, applied in the direction of interferon, cytokine/lymphokine/interferon, peptide/protein component, etc., can solve the problem of high antiviral activity, achieve a broad spectrum of antiviral, easy industrial production, purity high effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Embodiment 1 Synthesis and protein expression of recombinant porcine alpha-interferon protein gene
[0032] 1. The method for obtaining the target gene of recombinant porcine α-interferon
[0033] Referring to the nucleotide sequence of the recombinant porcine alpha-interferon gene (GENBANK number: NM_215383.1) the nucleotide sequence is shown in sequence 2 (SEQ ID NO.2) in the sequence table, and the primers are designed according to the above gene sequence as follows : Primer upstream sequence (5' CATATGTCCGACGCGCTAACCC 3') primer downstream sequence (5' TTATTCGTTCCGCAGGCGGACC 3') The restriction sites of the two primers are: 5' end plus NdeI restriction site CATATG, 3' end plus Pig blood was collected from the jugular vein of CTCGAG at the XhoI restriction site, and the total RNA of pig blood cells was extracted using the RNA extraction kit from Qiagen. Then perform reverse transcription PCR. In a 20 μL system, the specific sample volume is as follows: 10 μL of tota...
Embodiment 2
[0048] Example 2 Titer Detection of Recombinant Porcine α-Interferon Protein
[0049] Using the CPE inhibition-based inhibition microassay and using the Wish cell / VSV virus system, the reciprocal of the maximum dilutable multiple of interferon per milliliter that can protect half of the cells from virus infection is defined as interferon units, expressed in international units (IU ) and calibrated using national standards. Culture Wish cells with RPMI-1640 medium on a 96-well cell culture plate at a cell density of 350,000 / mL, add 100 μL per well, and place at 37°C, 5% CO 2 incubator for 5 hours. Add recombinant porcine interferon α-interferon at different dilutions, 37°C, 5% CO 2 Incubate for 24 hours. Aspirate the supernatant from each well, inoculate 100 μL of VSV virus suspension at a concentration of 100 CCID50 / mL in each well, and continue culturing for 24 hours. Observing the cell lesions under a microscope, the cells in the control group showed lesions such as shed...
Embodiment 3
[0050] Embodiment 3 Recombinant porcine α-interferon protein clinical trial
[0051] 1. The recombinant porcine α-interferon protein of the embodiment of the present invention treats classical swine fever
[0052] The number of diseased pigs clinically identified as swine fever and swine fever is 2033, which are about piglets and Duroc pigs. The age of pigs is 1-20 months, the age of piglets is 1-16 months, and the age of adult pigs is 1-20 months. More than 16 months, they were divided into 1304 test groups and 729 control groups, wherein the test group used the recombinant porcine α-interferon protein prepared in Example 1 of the present invention. The therapeutic dosage is 100,000 IU / kg for piglets, 200,000 IU / kg for adult pigs, and the control group is the existing one. The statistical results of the clinical symptoms of treating classical swine fever are shown in Table 1.
[0053] Table 1
[0054]
[0055] 2. Recombinant porcine α-interferon protein of the embodimen...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


