Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Construction method and application of agrobacterium Ti plasmid vector PCHF1302

A technology of plasmid vector and construction method, applied in application, botanical equipment and method, biochemical equipment and method, etc., can solve the problems of lack of target gene expression, construction of gene expression vector, etc.

Pending Publication Date: 2019-06-25
JILIN UNIV
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the commonly used plant expression vectors have various defects.
For example, Pcambia1301 and Pcambia1302 lack the 35S promoter and terminator for the expression of the target gene, so they cannot be directly used to construct gene expression vectors

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method and application of agrobacterium Ti plasmid vector PCHF1302
  • Construction method and application of agrobacterium Ti plasmid vector PCHF1302
  • Construction method and application of agrobacterium Ti plasmid vector PCHF1302

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0027] Cloning of Soybean OLEOSIN2 Gene and Construction of Expression Vector

[0028] 1. Acquisition of the target gene

[0029] 1. Obtain the sequence of the OLEOSIN2 gene on the Soybase website (https: / / www.soybase.org / ), and use the NCBI primer blast website (https: / / www.ncbi.nlm.nih.gov) to design the primer OLE according to the transcriptome sequence -F and OLE-R.

[0030] OLE-F: ACACACCCCACTAACAATTCC

[0031] OLE-R:AGACACGAACGAACGTCCCCTAC

[0032] 2. Using the cDNA of Williams 82 as a template, using RT-PCR technology to clone the OLEOSIN2 gene ( figure 1 ), the PCR product was recovered with TIANgel Midi Purification Kit after 1% agarose gel electrophoresis. The specific operation was carried out according to the instructions of the kit.

[0033] 3. Use the instrument to measure the concentration of the recovered product, and adjust the volume of the added fragment and TAKARA PMD-18T carrier reasonably according to the range of the fragment and carrier molar conc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a construction method and application of an agrobacterium Ti plasmid vector PCHF1302 and belongs to the technical field of plant genes. Double enzyme digestion is simultaneously conducted on enzyme digestion sites ECORI and HindIII on an agrobacterium Ti plasmid Pcambia 1302, wherein the PCHF3300 comprises a 35S promoter, a NOS terminator and a complete gene expression frame of MCS, a homologous arm is added through PCR, an expression frame started by the 35S promoter is successfully connected to the plasmid Pcambia 1302, and the PCHF1302 is constructed; the target genecloned by PCR and other methods can be conveniently connected to a plurality of cloning enzyme digestion sites (MCS), so that the target gene can be stably expressed in plants; a TDNA region containing hygromycin resistance gene and mGFP5 green fluorescent protein reporter gene can significantly improve the screening effect of transgenic plants.

Description

technical field [0001] The invention belongs to the technical field of plant genes, and in particular relates to a construction method and application of an Agrobacterium Ti plasmid vector PCHF1302. Background technique [0002] In recent years, plant genetic engineering technology has developed rapidly, especially transgenic technology plays a key role in the study of gene function. Through transgenic technology, we can transfer the gene to be studied into the source plant of the gene or other model plants to study the gene function. The construction of the gene expression vector needs to be completed before the transgenesis. However, the commonly used plant expression vectors have various defects. For example, Pcambia1301 and Pcambia1302 lack the 35S promoter and terminator for the expression of the target gene, so they cannot be directly used to construct gene expression vectors. Contents of the invention [0003] The object of the invention is to provide a method fo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/84C12N15/65C12N15/66
Inventor 王庆钰王康李景文张宇晨王英闫帆刘雅婧杨旭光张鑫生赵磊隋媛媛
Owner JILIN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com