Construction method and application of agrobacterium Ti plasmid vector PCHF1302
A technology of plasmid vector and construction method, applied in application, botanical equipment and method, biochemical equipment and method, etc., can solve the problems of lack of target gene expression, construction of gene expression vector, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0027] Cloning of Soybean OLEOSIN2 Gene and Construction of Expression Vector
[0028] 1. Acquisition of the target gene
[0029] 1. Obtain the sequence of the OLEOSIN2 gene on the Soybase website (https: / / www.soybase.org / ), and use the NCBI primer blast website (https: / / www.ncbi.nlm.nih.gov) to design the primer OLE according to the transcriptome sequence -F and OLE-R.
[0030] OLE-F: ACACACCCCACTAACAATTCC
[0031] OLE-R:AGACACGAACGAACGTCCCCTAC
[0032] 2. Using the cDNA of Williams 82 as a template, using RT-PCR technology to clone the OLEOSIN2 gene ( figure 1 ), the PCR product was recovered with TIANgel Midi Purification Kit after 1% agarose gel electrophoresis. The specific operation was carried out according to the instructions of the kit.
[0033] 3. Use the instrument to measure the concentration of the recovered product, and adjust the volume of the added fragment and TAKARA PMD-18T carrier reasonably according to the range of the fragment and carrier molar conc...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap