Application of amino acid sequence in identifying odor compounds
A compound and amino acid technology, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problems that attractants occupy for a long time, the identification process of volatile components is complicated, and the process is complicated
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0030] 1. Cloning and cRNA synthesis of the cotton bollworm odorant receptor gene HarmOR59
[0031] 1.1 Take the antennae of cotton bollworm 1-3 days after eclosion, extract RNA and reverse it into cDNA;
[0032] 1.2 According to the sequence of HarmOR59 mRNA (SEQ ID No.1, which corresponds to the encoded amino acid sequence of SEQ ID No.2), design primer OR59-F (SEQ ID No.3) and primer OR59-R (SEQ ID No.4) , use the cDNA obtained in step 1.1 as a template to clone the coding sequence of HarmOR59 (SEQ ID No.1), connect the clone to pMD-19, transfer to Escherichia coli competent cells and culture at 37°C overnight, pick a single clone and sequence to determine the gene sequence , to obtain pMD-HarmOR59;
[0033] 1.3 Synthesis of expression vector primers OR59-PT7Ts-F (SEQ ID No.5), OR59-PT7Ts-R (SEQ ID No.6), OR59-PT7Ts-F primers consist of: 20 nuclei identical to those upstream of the expression vector Nucleotide sequence (acgctcaacttggcagatct)+Kozak sequence (gccacc)+full-l...
Embodiment 2
[0046] Preparation of attractant mother solution:
[0047] Pipette 20 μL trans-2-hexenol (tans-2-Hexon-1-ol), 10 μL cinnamaldehyde (Cinnamaldehyde), 9 μL alpha-pinene (α-Pinene), 4 μL limonene (Limonen), 8 μL eucalyptol ( Eucalypol), using n-hexane (Hexane) as a solvent, dilute to a final volume of 1 mL, and mix well. A 10-fold attractant stock solution of 2v% trans-2-hexenol, 1v% cinnamaldehyde, 0.9v% alpha pinene, 0.4v% limonene and 0.8v% eucalyptol was obtained. The prepared attractant mother solution can be stored in a refrigerator at -22°C. When used, the mother liquor of attractant was diluted 10 times with n-hexane.
[0048] Preparation of attractants:
[0049] Aspirate 500 μL of the attractant mother solution, add n-hexane to a final volume of 5 mL, and mix well. Attractants of 2 v‰ trans-2-hexenol, 1 v‰ cinnamaldehyde, 0.9 v‰ alpha pinene, 0.4 v‰ limonene and 0.8 v‰ eucalyptol were obtained.
[0050] The solvent n-hexane was used as a negative control.
Embodiment 3
[0055] lure experiment
[0056] Indoor Y-tube lure test was carried out on the attractant.
[0057] Location: The experiment was carried out in the laboratory of Institute of Plant Protection, Chinese Academy of Agricultural Sciences.
[0058] Time: The test time is from 18:00 in the evening to 2:00 in the morning.
[0059] Indoor conditions: temperature 26-28°C, humidity 30%-50%; in order to prevent light from affecting behavior selection, red light was used as the light source.
[0060] Equipment and settings: The Y-shaped tube is made of glass, the angle between the arms A and B on both sides is 60°, the length is 20cm respectively, the length of the straight arm is 25cm, the diameter of the three arms is 4cm, and the openings of the two side arms are respectively inserted with a The rubber stopper of the rubber hose is plugged; after the airflow is collected by the atmospheric sampler, it passes through the glass drying tower with activated carbon and the glass wetting t...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com