Supercharge Your Innovation With Domain-Expert AI Agents!

Application of amino acid sequence in identifying odor compounds

A compound and amino acid technology, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problems that attractants occupy for a long time, the identification process of volatile components is complicated, and the process is complicated

Inactive Publication Date: 2019-07-02
INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, for the development of plant-derived insect attractant components, the main problems encountered in traditional methods are: 1. Complicated procedures: the identification process of volatile components is complicated to operate; 2. Large workload: the number of plant volatile components There are many, using behavioral experiments to verify the attracting effect of different components one by one is a huge workload; 3. Long development cycle: each step of attractant development takes a long time

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] 1. Cloning and cRNA synthesis of the cotton bollworm odorant receptor gene HarmOR59

[0031] 1.1 Take the antennae of cotton bollworm 1-3 days after eclosion, extract RNA and reverse it into cDNA;

[0032] 1.2 According to the sequence of HarmOR59 mRNA (SEQ ID No.1, which corresponds to the encoded amino acid sequence of SEQ ID No.2), design primer OR59-F (SEQ ID No.3) and primer OR59-R (SEQ ID No.4) , use the cDNA obtained in step 1.1 as a template to clone the coding sequence of HarmOR59 (SEQ ID No.1), connect the clone to pMD-19, transfer to Escherichia coli competent cells and culture at 37°C overnight, pick a single clone and sequence to determine the gene sequence , to obtain pMD-HarmOR59;

[0033] 1.3 Synthesis of expression vector primers OR59-PT7Ts-F (SEQ ID No.5), OR59-PT7Ts-R (SEQ ID No.6), OR59-PT7Ts-F primers consist of: 20 nuclei identical to those upstream of the expression vector Nucleotide sequence (acgctcaacttggcagatct)+Kozak sequence (gccacc)+full-l...

Embodiment 2

[0046] Preparation of attractant mother solution:

[0047] Pipette 20 μL trans-2-hexenol (tans-2-Hexon-1-ol), 10 μL cinnamaldehyde (Cinnamaldehyde), 9 μL alpha-pinene (α-Pinene), 4 μL limonene (Limonen), 8 μL eucalyptol ( Eucalypol), using n-hexane (Hexane) as a solvent, dilute to a final volume of 1 mL, and mix well. A 10-fold attractant stock solution of 2v% trans-2-hexenol, 1v% cinnamaldehyde, 0.9v% alpha pinene, 0.4v% limonene and 0.8v% eucalyptol was obtained. The prepared attractant mother solution can be stored in a refrigerator at -22°C. When used, the mother liquor of attractant was diluted 10 times with n-hexane.

[0048] Preparation of attractants:

[0049] Aspirate 500 μL of the attractant mother solution, add n-hexane to a final volume of 5 mL, and mix well. Attractants of 2 v‰ trans-2-hexenol, 1 v‰ cinnamaldehyde, 0.9 v‰ alpha pinene, 0.4 v‰ limonene and 0.8 v‰ eucalyptol were obtained.

[0050] The solvent n-hexane was used as a negative control.

Embodiment 3

[0055] lure experiment

[0056] Indoor Y-tube lure test was carried out on the attractant.

[0057] Location: The experiment was carried out in the laboratory of Institute of Plant Protection, Chinese Academy of Agricultural Sciences.

[0058] Time: The test time is from 18:00 in the evening to 2:00 in the morning.

[0059] Indoor conditions: temperature 26-28°C, humidity 30%-50%; in order to prevent light from affecting behavior selection, red light was used as the light source.

[0060] Equipment and settings: The Y-shaped tube is made of glass, the angle between the arms A and B on both sides is 60°, the length is 20cm respectively, the length of the straight arm is 25cm, the diameter of the three arms is 4cm, and the openings of the two side arms are respectively inserted with a The rubber stopper of the rubber hose is plugged; after the airflow is collected by the atmospheric sampler, it passes through the glass drying tower with activated carbon and the glass wetting t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an application of an amino acid sequence in identifying odor compounds. Specifically, the invention relates to the application of the amino acid sequence shown in SEQ ID No.2in identifying the odor compounds. The odor compounds are at least one of trans-2-hexenol, cinnamaldehyde, methyl phenylacetate, 4-ethylacetophenone, trans-3-hexenol and n-octanol.

Description

technical field [0001] This application relates to the application of an amino acid sequence in identifying odorous compounds. Background technique [0002] Cotton bollworm (Helicoverpa armigera), which belongs to Lepidoptera and Noctuidae pests, is widely distributed in many provinces of China and other parts of the world. Its larvae are highly omnivorous and feed on more than 120 kinds of plants including corn, soybean, cotton, tomato and other major economic crops, causing serious economic losses. The adults are highly migratory, and the females have a strong ability to lay eggs, with a maximum of more than 1,000 eggs, while the males have been reported to mate many times, so the control of cotton bollworm is a big problem. The large-scale use of pesticides has brought about various problems, such as ecological pollution and increased resistance of pests. Integrated pest management (IPM) has been a control strategy strongly supported by many countries in the world. In ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/705C12N15/12G01N27/00
CPCC07K14/705G01N27/00
Inventor 郭孟博刘杨王桂荣
Owner INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More