Application of a glycerol-2-α-glucosylase in the preparation of 2-α-glycerol glucoside

A technology of glucoside and glucose, applied in the application field of glycerol-2-α-glucosylase in the preparation of 2-α-glycerol glucoside, which can solve the limitations of 2-α-GG production technology, low yield, Difficult industrialization and other problems, to achieve the effect of separation and purification, high catalytic activity, high product concentration

Active Publication Date: 2021-02-02
ZHEJIANG UNIV OF TECH
View PDF4 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] 2-α-GG has broad application prospects in cosmetics, medicine and other industries, but it is limited to the production technology of 2-α-GG, and the price of high-purity products remains high
Among them, the chemical method lacks stereo and regiospecificity, the products are diverse, and the yield is low; many enzymatic conversion products also contain products with multiple glycosylation sites, and it is difficult to obtain a single product 2-α-GG; the direct extraction method , its yield is too low, the cost is high, and it is difficult to industrialize

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of a glycerol-2-α-glucosylase in the preparation of 2-α-glycerol glucoside
  • Application of a glycerol-2-α-glucosylase in the preparation of 2-α-glycerol glucoside

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Embodiment 1, the preparation of the catalytic bacterial agent of producing 2-alpha-GG

[0031] 1. Construction of Escherichia coli-lpmsp containing glycerol-2-α-glucosylase

[0032] Genomic DNA (NCBI accession number is MK370897) of Leuconostoc pseudosenteroides L. pseudomesenteroides in the mid-logarithmic growth phase was extracted using a bacterial genomic DNA extraction kit, and used as a template to perform PCR amplification with the following primers:

[0033] lpmSP-F:

[0034] GCCTGGTGCCGCGCGGCAGCCATATGGAAATTCAAAACAAAGCAATG;

[0035] lpmSP-R:

[0036] GTCGACGGAGCTCGAATTCGGATCCTTAGTTCTGAGTCAAATCATC.

[0037] The high-efficiency fidelity enzyme Phanta Max Super-Fidelity DNA Polymerase from Vazyme Biotech Co., Ltd. was used for PCR amplification. The PCR amplification program was: 95°C for 3min; 95°C for 15s, 58°C 15s at ℃, 1.5min at 72℃, 30 cycles; 5min at 72℃.

[0038] The obtained PCR product was purified using a PCR product recovery kit, and cloned between...

Embodiment 2

[0044] Application of embodiment 2 bacterial agents in the production of 2-alpha-GG

[0045] 1. Catalyst activity detection

[0046] Resuspend 1 g of the wet bacterial cells prepared by the method in Example 1 in 20 mL of pH 7.0, 2.5 mM phosphate buffer; add glycerol with a final concentration of 132 g / L and sucrose of 342 g / L, at 30 ° C and 220 rpm Catalyzed on a water bath shaker for 24 hours, the reaction solution was used for HPLC analysis, the measured residual substrate sucrose concentration was 18.81g / L, the formed product 2-α-GG concentration was 43.6g / L, and the substrate sucrose conversion rate was 94.5% .

[0047] Liquid chromatography detection conditions. Sample pretreatment: add 100 μL of reaction solution to 900 μL of 0.01mol / L dilute hydrochloric acid; centrifuge at 10000×g for 5 minutes, filter with a 0.22 μm filter membrane, and add the filtrate to a liquid phase vial; chromatographic column: Sugar-Ca column, 300×7.8mm; column temperature: 80°C, detector t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses the application of a glycerol-2-α-glucosylase in the preparation of 2-α-glycerol glucoside. The amino acid sequence of the glycerol-2-α-glucosylase is represented by SEQ ID NO.2 Show; The recombinant Escherichia coli that produces 2-α-GG of the present invention, i.e. recombinant Escherichia coli (Escherichia coli) IEF-bpmsp208 can efficiently synthesize sucrose phosphorylase in the cell, take glycerol and sucrose as substrates, efficiently catalyze glycerol Glycosylation reaction, reaction for 18-24 hours, more than 10% 2-α-GG solution can be obtained, and the conversion rate of substrate sucrose is greater than 92%, the product concentration of 2-α-GG is high, and the conversion rate is high , which is beneficial to the separation and purification of 2‑α‑GG.

Description

[0001] (1) Technical field [0002] The invention relates to the application of a glycerol-2-α-glucosylase-containing enzyme in the production of 2-α-glycerol glucoside (2-O-α-D-glucosylglycerol, hereinafter referred to as 2-α-GG). [0003] (2) Background technology [0004] 2-α-Glycerol glucoside (2-α-GG) is a kind of substance that is composed of glycerol molecules and glucose molecules with glycosidic bonds. The structural formula is as follows figure 1 As shown, it couples a D-glucopyranose and the hydroxyl group at the No. 2 position of glycerol through a glycosidic bond, and is a natural protective agent for various plants, algae and bacteria in nature against drought and high-salt environments. The configuration of the glucose molecule combined with the position of the glycerol molecule can be divided into many types, and six types have been identified so far, but 2-α-GG is the natural osmotic pressure resistance molecule. It is an osmotic protection substance synthesiz...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12P19/44C12P19/14C12N15/70C12N15/53C12N9/24
CPCC12N9/24C12N15/70C12P19/14C12P19/44
Inventor陈小龙江丹朱林江陆跃乐范永仙陈翰驰
OwnerZHEJIANG UNIV OF TECH