Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of Lettuce Gene rll4 in Controlling Lettuce Leaf Color

A gene and color technology, applied in the application field of lettuce gene RLL4 in controlling the color of lettuce leaves, can solve the problems of unanalyzed, uncloned, unstudied genetic laws, etc.

Inactive Publication Date: 2020-12-01
HUAZHONG AGRI UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The applicant found that the trait controlling the redness of leaves in lettuce is an unreported trait controlling color, and its genetic law has not been analyzed, and the gene controlling the red color of lettuce has not been cloned, and the function of this gene has not been studied

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of Lettuce Gene rll4 in Controlling Lettuce Leaf Color
  • Application of Lettuce Gene rll4 in Controlling Lettuce Leaf Color

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0015] Precise mapping of the RLL4 gene

[0016] In the present invention, the green lettuce is used as the female parent, and the red lettuce is used as the male parent for hybridization, and the true hybrid F is selected. 1 Plants were selfed and F 2 generation seeds, followed by single seed subculture to obtain 114 F 4 generation family. Filter F 4 114 families were collected, and 32 families were found to have leaf color separation, among which the Q54 family had deep red and light red color separation. At the stage of four true leaves, the leaf color of 270 individual plants of Q54 population was obviously separated. Observation and statistical phenotypes showed that the separation ratio of leaf color depth was 195:75 (light red: deep red)≈3:1 (P>0.05).

[0017] Using the method of combining extreme mixed pool BSA and second-generation sequencing RNA-seq (Zou et al., 2016), the leaf color regulatory genes were quickly initially located. Select 35 dark red plants, ta...

Embodiment 2

[0020] Application of gene RLL4 in the preparation of control lettuce leaf color:

[0021] Using the designed primers LsWD40-OVERGFP-R: cccggggtcgacgggcatatgagttaacggttttctttttccgg and LsWD40-OVERGFP-F: caagttcttcactgttgatacatatgatgaaaaacgtctcattcaatcag) specific primers for the RLL4 gene, amplified from green lettuce material with Phanta Super-Fidelity DNA S. Sequence, amplified product homologous recombination (Vazyme company) to the overexpression vector pRI101 carrier of NdeI digestion (construction process refers to the ClonExpress of Vazyme company TM II instructions), transformed into Escherichia coli Trans1-T1 (purchased from Quanshijin Company) and screened positive clones. Agrobacterium-mediated transformation was adopted, and the Agrobacterium strain was hypervirulent strain GV3101 (purchased from Shanghai Weidi Company). The vector is driven by a 35S promoter, and the selectable marker gene is Kanamycin (Kan). The recipient of the transgene is a commercial varie...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of plant genetic engineering, and particularly discloses an application of a lettuce gene RLL4 in controlling color of lettuce leaves. The gene has a remarkable function of regulating the shade of red of the lettuce leaves, and can be applied to the shade of color of the lettuce leaves. The discovery of the RLL4 gene provides a new gene resource for cultivating lettuce with different red shades, and is favorable for cultivating new edible ornamental plant varieties.

Description

technical field [0001] The invention belongs to the technical field of plant engineering. In particular, it relates to the application of the lettuce gene RLL4 in controlling the color of lettuce leaves. Background technique [0002] Lettuce (Lactuca sativa) is one of the most important vegetables in the world. Lettuce genome sequencing has been completed, the genome is large (about 2.7Gb), of which 74.2% are repetitive sequences. Although sequenced, the functions of many genes are unknown. Lettuce is a common name for leaf lettuce. Because the anthocyanins in red lettuce have anti-oxidation, anti-cancer and anti-aging effects, red lettuce is more and more favored by consumers. The structural genes in the anthocyanin synthesis pathway have been studied very clearly in Arabidopsis and other plants, and the regulatory genes in the anthocyanin synthesis pathway are critical to anthocyanin synthesis and are species-specific. In red lettuce, there are many unknown anthocyanin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/415C12N15/29A01H5/12A01H6/14
CPCC07K14/415C12N15/825
Inventor 陈炯炯贺淑萍匡汉晖刘文叶陶蓉
Owner HUAZHONG AGRI UNIV