Application of Lettuce Gene rll4 in Controlling Lettuce Leaf Color
A gene and color technology, applied in the application field of lettuce gene RLL4 in controlling the color of lettuce leaves, can solve the problems of unanalyzed, uncloned, unstudied genetic laws, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0015] Precise mapping of the RLL4 gene
[0016] In the present invention, the green lettuce is used as the female parent, and the red lettuce is used as the male parent for hybridization, and the true hybrid F is selected. 1 Plants were selfed and F 2 generation seeds, followed by single seed subculture to obtain 114 F 4 generation family. Filter F 4 114 families were collected, and 32 families were found to have leaf color separation, among which the Q54 family had deep red and light red color separation. At the stage of four true leaves, the leaf color of 270 individual plants of Q54 population was obviously separated. Observation and statistical phenotypes showed that the separation ratio of leaf color depth was 195:75 (light red: deep red)≈3:1 (P>0.05).
[0017] Using the method of combining extreme mixed pool BSA and second-generation sequencing RNA-seq (Zou et al., 2016), the leaf color regulatory genes were quickly initially located. Select 35 dark red plants, ta...
Embodiment 2
[0020] Application of gene RLL4 in the preparation of control lettuce leaf color:
[0021] Using the designed primers LsWD40-OVERGFP-R: cccggggtcgacgggcatatgagttaacggttttctttttccgg and LsWD40-OVERGFP-F: caagttcttcactgttgatacatatgatgaaaaacgtctcattcaatcag) specific primers for the RLL4 gene, amplified from green lettuce material with Phanta Super-Fidelity DNA S. Sequence, amplified product homologous recombination (Vazyme company) to the overexpression vector pRI101 carrier of NdeI digestion (construction process refers to the ClonExpress of Vazyme company TM II instructions), transformed into Escherichia coli Trans1-T1 (purchased from Quanshijin Company) and screened positive clones. Agrobacterium-mediated transformation was adopted, and the Agrobacterium strain was hypervirulent strain GV3101 (purchased from Shanghai Weidi Company). The vector is driven by a 35S promoter, and the selectable marker gene is Kanamycin (Kan). The recipient of the transgene is a commercial varie...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 

