Rapid detecting primer set and kit of GeXP for detecting four kinds of flaviviruses simultaneously and application of rapid detecting kit
A technology for detection kits and detection primers, applied in the direction of microorganisms, recombinant DNA technology, methods based on microorganisms, etc., can solve problems such as no viruses, and achieve the effects of shortened detection time, high sensitivity, and high accuracy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031]Using the primer sequences published by GeBank as a reference, the gene sequences of DENV (type Ⅰ-Ⅳ), ZIKV, WNV, and YFV were downloaded from NCBI, the conserved regions were selected, and specific primers were designed using primer premier 5.0 software. The 'end is connected with universal primer G-F, the 3' end is connected with universal primer G-R, and the 5' end of G-F is labeled with cy5 fluorescent dye. The primer information of the present invention is shown in Table 1, and all primers were synthesized by Chengdu Qingke Zixi Biological Co., Ltd.
[0032] Table 1 Primer information
[0033]
[0034] The four pairs of specific primers in Table 1, ZK-F and ZK-R, DG-F and DG-R, YF-F and YF-R, WN-F and WN-R, were used to detect ZIKV, DENV, YFV and WNV.
Embodiment 2
[0036] Preparation of the template:
[0037] 1) Preparation of monoclonal plasmid standard: Artificially synthesize each specific primer corresponding to the target gene, and connect the target gene to the PMD19-T vector. The target gene is synthesized by Chengdu Qingke Zixi Biological Co., Ltd. and connected to PMD19-T on the carrier. Plasmid mini-extraction kits were used to extract ZK-PMD19T, DG-PMD19T, YF-PMD19T, WN-PMD19T plasmids, which were used as basic materials for subsequent PCR verification and quality control preparation. The corresponding sequences of each viral target gene are as follows:
[0038] ZK (350bp)
[0039] CACCAGCACTATGATGGAAACCATGGAGCGACTGCAACGTAGGCATGGGGGAGGATTAGTCAGAGTGCCATTGTGTCGCAACTCCACACATGAGATGTACTGGGTCTCTGGGGCAAAGAGCAACATCATAAAAAGTGTGTCCACCACAAGTCAGCTCCTCCTGGGACGCATGGATGGCCCCAGGAGGCCAGTGAAATATGAGGAGGATGTGAACCTCGGCTCGGGTACACGAGCTGTGGCAAGCTGTGCTGAGGCTCCTAACATGAAAATCATCGGCAGGCGCATTGAGAGAATCCGCAATGAACATGCAGAAACATGGTTTCTTGATGAAAACCACCCATACAGGACA...
Embodiment 3
[0050] 1. Single-plex RT-PCR method to verify specific primers:
[0051] 1) Optimization of annealing temperature: using the four viral plasmids obtained in Example 2 as templates for single-plex PCR amplification (multifunctional gradient PCR instrument Veriti96, purchased from Applied Biosystems, USA), the selected annealing temperatures were 55°C, 56.5°C, respectively. °C, 58 °C, 59.5 °C, 61 °C for gradient screening to determine the optimal annealing temperature for each specific primer pair.
[0052] Reaction system: 10×PCR Buffer 2.5μL, MgCl 2 1.5μL, dNTP Mixture 2μL, Hot StarTaq DNA Polymerase (5U / μL) 0.2μL, F / R primer (10μM) 0.5μL each, template 20ng, RNase FreeddH 2 O to make up to 25 μL.
[0053] Reaction conditions: pre-denaturation at 94°C for 5 minutes, denaturation at 94°C for 25s, annealing at 55°C, 56.5°C, 58°C, 59.5°C, 61°C for 25s, extension at 72°C for 30s, a total of 35 cycles, extension at 72°C for 5min, 4 Store at ℃. The amplified product was electro...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


