Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Rapid detecting primer set and kit of GeXP for detecting four kinds of flaviviruses simultaneously and application of rapid detecting kit

A technology for detection kits and detection primers, applied in the direction of microorganisms, recombinant DNA technology, methods based on microorganisms, etc., can solve problems such as no viruses, and achieve the effects of shortened detection time, high sensitivity, and high accuracy

Pending Publication Date: 2019-07-30
四川国际旅行卫生保健中心
View PDF7 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no report on simultaneous detection of Zika, yellow fever, dengue, and West Nile viruses

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rapid detecting primer set and kit of GeXP for detecting four kinds of flaviviruses simultaneously and application of rapid detecting kit
  • Rapid detecting primer set and kit of GeXP for detecting four kinds of flaviviruses simultaneously and application of rapid detecting kit
  • Rapid detecting primer set and kit of GeXP for detecting four kinds of flaviviruses simultaneously and application of rapid detecting kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031]Using the primer sequences published by GeBank as a reference, the gene sequences of DENV (type Ⅰ-Ⅳ), ZIKV, WNV, and YFV were downloaded from NCBI, the conserved regions were selected, and specific primers were designed using primer premier 5.0 software. The 'end is connected with universal primer G-F, the 3' end is connected with universal primer G-R, and the 5' end of G-F is labeled with cy5 fluorescent dye. The primer information of the present invention is shown in Table 1, and all primers were synthesized by Chengdu Qingke Zixi Biological Co., Ltd.

[0032] Table 1 Primer information

[0033]

[0034] The four pairs of specific primers in Table 1, ZK-F and ZK-R, DG-F and DG-R, YF-F and YF-R, WN-F and WN-R, were used to detect ZIKV, DENV, YFV and WNV.

Embodiment 2

[0036] Preparation of the template:

[0037] 1) Preparation of monoclonal plasmid standard: Artificially synthesize each specific primer corresponding to the target gene, and connect the target gene to the PMD19-T vector. The target gene is synthesized by Chengdu Qingke Zixi Biological Co., Ltd. and connected to PMD19-T on the carrier. Plasmid mini-extraction kits were used to extract ZK-PMD19T, DG-PMD19T, YF-PMD19T, WN-PMD19T plasmids, which were used as basic materials for subsequent PCR verification and quality control preparation. The corresponding sequences of each viral target gene are as follows:

[0038] ZK (350bp)

[0039] CACCAGCACTATGATGGAAACCATGGAGCGACTGCAACGTAGGCATGGGGGAGGATTAGTCAGAGTGCCATTGTGTCGCAACTCCACACATGAGATGTACTGGGTCTCTGGGGCAAAGAGCAACATCATAAAAAGTGTGTCCACCACAAGTCAGCTCCTCCTGGGACGCATGGATGGCCCCAGGAGGCCAGTGAAATATGAGGAGGATGTGAACCTCGGCTCGGGTACACGAGCTGTGGCAAGCTGTGCTGAGGCTCCTAACATGAAAATCATCGGCAGGCGCATTGAGAGAATCCGCAATGAACATGCAGAAACATGGTTTCTTGATGAAAACCACCCATACAGGACA...

Embodiment 3

[0050] 1. Single-plex RT-PCR method to verify specific primers:

[0051] 1) Optimization of annealing temperature: using the four viral plasmids obtained in Example 2 as templates for single-plex PCR amplification (multifunctional gradient PCR instrument Veriti96, purchased from Applied Biosystems, USA), the selected annealing temperatures were 55°C, 56.5°C, respectively. °C, 58 °C, 59.5 °C, 61 °C for gradient screening to determine the optimal annealing temperature for each specific primer pair.

[0052] Reaction system: 10×PCR Buffer 2.5μL, MgCl 2 1.5μL, dNTP Mixture 2μL, Hot StarTaq DNA Polymerase (5U / μL) 0.2μL, F / R primer (10μM) 0.5μL each, template 20ng, RNase FreeddH 2 O to make up to 25 μL.

[0053] Reaction conditions: pre-denaturation at 94°C for 5 minutes, denaturation at 94°C for 25s, annealing at 55°C, 56.5°C, 58°C, 59.5°C, 61°C for 25s, extension at 72°C for 30s, a total of 35 cycles, extension at 72°C for 5min, 4 Store at ℃. The amplified product was electro...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of virus detection, and discloses a rapid detecting primer set and kit of a GeXP for detecting four kinds of flaviviruses simultaneously and application ofthe rapid detecting kit. Based on the GeXP technology, four pairs of specific primers and a pair of universal primers are designed, a multi-PCR system is constructed on this basis, Zika viruses, yellow fever viruses, dengue viruses and west nile viruses can be detected at the same time, the detecting time is effectively shortened, the advantages of being high in specificity, high in sensitivity,high in accuracy, convenient, efficient and the like are achieved, and the rapid detecting primer set and kit have important significance on diagnosis, prevention and control of insectborne infectiousdisease viral diseases caused by the four kinds of viruses.

Description

technical field [0001] The invention belongs to the technical field of virus detection, and in particular relates to a GeXP rapid detection primer set, a kit and an application thereof for simultaneously detecting four flaviviruses. Background technique [0002] Flavivirus is the largest family of the Flaviviridae family, including 8 serological subgroups, composed of more than 70 viruses, of which more than 40 viruses are related to human diseases, including dengue virus (DENV), Japanese encephalitis virus (JEV), Zika virus (ZIKV), tick-borne encephalitis virus (TBEV), West Nile virus (WNV), Kujun virus (KUN) and yellow fever virus (YFV), most of which For arboviruses. These viruses are similar in structure, most of which are enveloped RNA viruses, which can proliferate in arthropods but are not pathogenic to arthropods, and can be transmitted to humans or other vertebrates through insect bites. [0003] Zika virus is a new arbovirus, which recently broke out in the Ameri...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/686C12N15/11C12R1/93
CPCC12Q1/701C12Q1/686C12Q2600/16C12Q2537/143Y02A50/30
Inventor 田绿波石莹高国龙樊学军
Owner 四川国际旅行卫生保健中心
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com