Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Cell immunofluorescence kit for determining phosphotyrosine adaptin ShcA antibody in human serum and preparation method and application of kit

A technology of phosphotyrosine and fluorescent kits, which is applied in the field of immunological detection, and achieves the effects of high accuracy, simple operation and short time consumption

Active Publication Date: 2019-09-20
JIANGSU PROVINCE HOSPITAL THE FIRST AFFILIATED HOSPITAL WITH NANJING MEDICAL UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Accumulating evidence suggests that stable nephrin expression on the cell surface is regulated by endocytosis and that defects in nephrin turnover may lead to proteinuria

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cell immunofluorescence kit for determining phosphotyrosine adaptin ShcA antibody in human serum and preparation method and application of kit
  • Cell immunofluorescence kit for determining phosphotyrosine adaptin ShcA antibody in human serum and preparation method and application of kit
  • Cell immunofluorescence kit for determining phosphotyrosine adaptin ShcA antibody in human serum and preparation method and application of kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] Preparation of bioslides expressing ShcA transfected cells:

[0059] 1. Cell transfection:

[0060] ShcA is an adapter protein that binds to tyrosine kinase receptors. There are three splicing isoforms: p46shc, p52shc and p66shc. We believe that simultaneous detection of the three structures is the optimal diagnostic detection scheme. In the slice, the plasmids of the three constructs were simultaneously transfected into cells.

[0061] Plasmids for transfection:

[0062] ①p46shc plasmid:

[0063] Using the SchA gene DNA as a template, design primers to amplify the target fragment, digest with BamHI and HindIII and connect to the pet28a plasmid to transform E.coliDH5α, pick positive clones for sequencing, and extract plasmids from the correct clones.

[0064] Primer name sequence 5'-3' p46shc upstream primer 5'TTAGTGAGGCCGGAAGTGAGT 3' p46shc downstream primer 5'AGCAATGGAAAAGAAAATAGGAAAG 3'

[0065] ②p52shc plasmid:

[0066] Using DNA a...

Embodiment 2

[0091] Application of the kit of embodiment 1: according to the diagnostic criteria of nephrotic syndrome, ((1) urinary protein is greater than 3.5g / d; (2) plasma albumin is lower than 30g / L; (3) edema; (4) hyperlipidemia Hyperemia.) And exclude renal biopsy contraindications, patients with clear renal biopsy pathological diagnosis, use 15 cases of nephrotic syndrome and obtain serum samples of renal biopsy pathological diagnosis, serum samples of 15 healthy adults, use the method in Example 1 The prepared immunofluorescence kit for serum phosphotyrosine adapter protein ShcA antibody was used for semi-quantitative determination, and the results are shown in the table below.

[0092] Table 1 ShcA antibody detection results

[0093]

[0094]

[0095] The invention realizes the semi-quantitative detection of the ShcA antibody in the human serum by diluting the serum sample with different gradients, and the operation is simple and convenient. It can be used for the diagnosi...

Embodiment 3

[0098] Embodiment 3 (comparative example):

[0099] The difference between this example and Example 1 is that only p46shc is transfected, the detection specificity and sensitivity are poor, and accurate detection cannot be achieved.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention discloses a cell immunofluorescence kit for determining phosphotyrosine adaptin ShcA antibody in human serum and a preparation method and application of the kit. The kit comprises a kit body, biological slide glass arranged in the box body, a coverslip and reagents in the kit body, the biological slide glass is coated with phosphotyrosine adaptin ShcA transfection cells, and the reagents include a fluorescence antibody reagent, a positive control, a negative control, a serum sample dilute solution, a condensed washing lotion and a mounting medium. The kit can be used as a diagnosis kit to detect the concentration of phosphotyrosine adaptin ShcA antibody in serum of patients with lupus nephritis, diabetic nephropathy or IgAN, MN and FSGS podocytopathy, the diagnosis specificity is 100, and the diagnosis sensitivity is 98.1%.

Description

technical field [0001] The invention belongs to the technical field of immunological detection, and in particular relates to a cell immunofluorescence kit for measuring human serum phosphotyrosine adapter protein ShcA antibody and a preparation method and application thereof. Background technique [0002] Podocytes play a key role in maintaining the integrity of the renal hemofiltration barrier. These specialized epithelial cells extend an actin-based network of intersecting foot processes bridged by a unique cell junction called the slit septum. An essential component of the slit diaphragm is the transmembrane protein nephrin, which through cis and trans interactions of its extracellular domain, nephrin contributes to the formation of the filtration pore size, which largely determines the filtration protein selectivity. Aberrant expression of renin and other slit-diaphragm molecules (eg, podocin) results in loss of foot processes and loss of essential plasma proteins into...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/68
CPCG01N33/68
Inventor 段俗言邢昌赢袁杨刚张承宁张波
Owner JIANGSU PROVINCE HOSPITAL THE FIRST AFFILIATED HOSPITAL WITH NANJING MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com