Cell immunofluorescence kit for determining phosphotyrosine adaptin ShcA antibody in human serum and preparation method and application of kit
A technology of phosphotyrosine and fluorescent kits, which is applied in the field of immunological detection, and achieves the effects of high accuracy, simple operation and short time consumption
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0058] Preparation of bioslides expressing ShcA transfected cells:
[0059] 1. Cell transfection:
[0060] ShcA is an adapter protein that binds to tyrosine kinase receptors. There are three splicing isoforms: p46shc, p52shc and p66shc. We believe that simultaneous detection of the three structures is the optimal diagnostic detection scheme. In the slice, the plasmids of the three constructs were simultaneously transfected into cells.
[0061] Plasmids for transfection:
[0062] ①p46shc plasmid:
[0063] Using the SchA gene DNA as a template, design primers to amplify the target fragment, digest with BamHI and HindIII and connect to the pet28a plasmid to transform E.coliDH5α, pick positive clones for sequencing, and extract plasmids from the correct clones.
[0064] Primer name sequence 5'-3' p46shc upstream primer 5'TTAGTGAGGCCGGAAGTGAGT 3' p46shc downstream primer 5'AGCAATGGAAAAGAAAATAGGAAAG 3'
[0065] ②p52shc plasmid:
[0066] Using DNA a...
Embodiment 2
[0091] Application of the kit of embodiment 1: according to the diagnostic criteria of nephrotic syndrome, ((1) urinary protein is greater than 3.5g / d; (2) plasma albumin is lower than 30g / L; (3) edema; (4) hyperlipidemia Hyperemia.) And exclude renal biopsy contraindications, patients with clear renal biopsy pathological diagnosis, use 15 cases of nephrotic syndrome and obtain serum samples of renal biopsy pathological diagnosis, serum samples of 15 healthy adults, use the method in Example 1 The prepared immunofluorescence kit for serum phosphotyrosine adapter protein ShcA antibody was used for semi-quantitative determination, and the results are shown in the table below.
[0092] Table 1 ShcA antibody detection results
[0093]
[0094]
[0095] The invention realizes the semi-quantitative detection of the ShcA antibody in the human serum by diluting the serum sample with different gradients, and the operation is simple and convenient. It can be used for the diagnosi...
Embodiment 3
[0098] Embodiment 3 (comparative example):
[0099] The difference between this example and Example 1 is that only p46shc is transfected, the detection specificity and sensitivity are poor, and accurate detection cannot be achieved.
PUM
Property | Measurement | Unit |
---|---|---|
Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com