High-affinity anti-cyclic citrullinated peptide tetravalent micro-molecule antibody and preparation method and application thereof

An anti-cyclic citrullinated peptide, small molecule antibody technology, applied in chemical instruments and methods, antibodies, antibody mimics/scaffolds, etc., can solve problems such as lack of high-affinity anti-CCP antibodies, and achieve the effect of eliminating space obstacles

Active Publication Date: 2019-09-24
内蒙古医科大学附属医院
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] In addition, the lack of high-affinity anti-CCP antibodies has become a "bottleneck" problem in studying the role of this antibody in the pathogenesis of RA

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High-affinity anti-cyclic citrullinated peptide tetravalent micro-molecule antibody and preparation method and application thereof
  • High-affinity anti-cyclic citrullinated peptide tetravalent micro-molecule antibody and preparation method and application thereof
  • High-affinity anti-cyclic citrullinated peptide tetravalent micro-molecule antibody and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061] Example 1: High affinity anti-cyclic citrullinated peptide single-chain variable region tetravalent small molecule antibody

[0062] This example provides a high-affinity anti-cyclic citrullinated peptide single-chain variable region tetravalent small molecule antibody based on human p53, whose sequence includes the following parts:

[0063] 1. Anti-CCP ScFv-sequence

[0064] The anti-CCP ScFv antibody gene sequence that has been constructed in the pHEN2 phage expression system in the previous research, specifically:

[0065] CAGGTGCAGCTGCAGGAGTCGGGCCCAGGAGTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTG CGCTGTCTCTGGTGGCTCCATGACTAATTATTACTGGGACTGGATTCGGCAGTCCCCAGGGAAGGGA CCGGAGTGGATTGGGTATATCTATTACAGTGGGAACACCAAGTACAACCCCTCCCTCAAGAGTCGA GTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAGGCTGACCTCCGTGACCGCCGCA GACACGGCCGTGTATTATTGTGCGAGACATAATGCATATTACTATGACAGAAGTGGTTACTACTTCCC TGAATACTTCCGACACTGGGGCCAGGGCACCCTGGTCACCGTCTCCTCGGCATCCACCAAGGGCCC ATCGGTCACTTCGAGTGGTGGAGGCGGTAGTGCACAGGATGTTGTGAT...

Embodiment 2

[0082] Example 2: Preparation of high-affinity tetravalent small molecule antibody against cyclic citrullinated peptide single-chain variable region

[0083] This example provides a specific preparation method for a high-affinity anti-cyclic citrullinated peptide single-chain variable region tetravalent small molecule antibody. For the construction model of pET28(a)-anti-CCP ScFv-HAS-P53, please refer to figure 1 As shown, pET28(a)-anti-CCPScFv-HAS-P53 construction technical route can refer to figure 2 Shown; The method includes the following specific steps:

[0084] 1) Extract pHEN2-anti-CCP ScFv phage plasmid DNA (Promega, A1330) and amplify it, and introduce enzyme cutting sites;

[0085] 2) digestion and linking Anti-CCP ScFv-sequence, linker protein sequence HSA-linker and P53 quadruple domain;

[0086] 3) The ligation product was transformed into competent Escherichia coli DH5a;

[0087] 4) Extract colony plasmid DNA, PCR amplification and NcoI and EcoRI double enzym...

Embodiment 3

[0112] Example 3: Detection of secretory B lymphocytes

[0113] In this embodiment, the peripheral blood mononuclear cells (PBMC) of RA patients with high active disease activity were cultured in vitro, so as to detect the effect of the anti-CCP antibody (SEQ ID NO: 2) provided in Example 1 on the secretion of CCP antibody B lymphocytes stimulated by CCP antigen. Cell number and function.

[0114] 1. Experimental materials and methods

[0115] (1) Experimental materials: 5 patients with rheumatoid arthritis who underwent arthroscopic synovectomy or surgical replacement of the joint synovium, all in line with the 1987 ACR RA classification diagnostic criteria, DAS28 score ≥ 3.2, tender joint number ≥ 8 / 68, the number of swollen joints ≥ 6 / 68, hsCRP ≥ 10mg / dl, age 35-55 years old, average 55.40±6.06 years old, all female, 5 female patients with trauma and osteoarthritis joint replacement, age 56.0±8.70 years old, Sign the informed consent form, and file with the Ethics Commit...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Apertureaaaaaaaaaa
Login to View More

Abstract

The present invention relates to a high-affinity anti-cyclic citrullinated peptide single-chain variable region tetravalent micro-molecule antibody. The invention proves that an anti-CCP antibody is not only a serologic marker for RA diagnosis, but also plays an important role in RA pathogenesis, and provides a test basis for RA targeted therapy with a citrullinated antigen as a target. In the present invention, a CCP epitope is used as a therapeutic target and an entry point. The research content involves multiple levels at which the CCP may be involved in the RA pathogenesis, so as to systematically and comprehensively reveal the role of the anti-CCP antibody in the RA pathogenesis. The peptide chain of an anti-CCP- ScFv antibody and a tetramer antibody with a P53 framework used in the invention are completely humanized sequences, acted on and targeted to an initiation of the RA pathogenesis and chronic process of inflammation, so as to have more pertinence. Different from existing downstream inflammatory response mediators and inflammatory signaling pathway mediators that antagonize the RA pathogenesis, the high-affinity anti-cyclic citrullinated peptide tetravalent micro-molecule antibody of the invention has more leading and accurate targetability of the target, and has better potential for transformation of technological achievements and prospect for biopharmaceutical development. In addition, an anti-CCP+RA and an anti-CCP-RA targeted by the high-affinity anti-cyclic citrullinated peptide tetravalent micro-molecule antibody of the invention may be two different disease subtypes of the RA, so that the antibody may become a new hope for accurately targeted therapy for such patients.

Description

technical field [0001] The present invention relates to the diagnosis and treatment of rheumatoid arthritis, in particular to a high-affinity anti-cyclic citrullinated peptide tetravalent small molecule antibody that can be used for diagnosis and treatment of rheumatoid arthritis. Background technique [0002] Rheumatoid arthritis (RA) is an autoimmune disease with chronic and progressive synovitis as the main pathological changes involving multiple organ systems. The prevalence rate in my country is 0.32-0.38%, with a cumulative population of more than 5 million, with high disability and death rates. Bone destruction occurs within 2 years of onset in 80% of patients. Anti-cyclic citrullinated peptide (CCP) antibody has a sensitivity of 61.6-75.2% and a specificity of 94-99% for the diagnosis of RA, and can be detected 10 years before clinical symptoms appear. More and more recent studies have shown that anti-CCP antibodies are not only a serological marker for the diagnos...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/70G01N33/68A61K39/395A61P19/02A61P29/00
CPCC07K16/18C07K14/4746C12N15/70G01N33/6893A61P19/02A61P29/00C07K2319/00C07K2317/622C07K2317/92A61K2039/505G01N2800/102
Inventor李鸿斌王静任婷婷
Owner内蒙古医科大学附属医院