Check patentability & draft patents in minutes with Patsnap Eureka AI!

Recombinant expression carrier and construction method and application thereof

A technology of recombinant vectors and expression vectors, applied in the field of genetic engineering, can solve the problems of low expression, inability to study functions, low expression of recombinant proteins, etc., and achieve the effect of promoting high expression

Active Publication Date: 2019-10-18
点斗基因科技(南京)有限公司
View PDF8 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] In view of the low expression level of foreign genes or ELP fusion proteins connected with foreign genes, high host protein content, low expression and difficult purification of some recombinant proteins, resulting in the inability to industrialize or study their functions, we provide the following Technical solutions:

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant expression carrier and construction method and application thereof
  • Recombinant expression carrier and construction method and application thereof
  • Recombinant expression carrier and construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Synthetic pentapeptide repeat unit (VPGXG)n of elastin-like polypeptide (ELP)m. According to Val-Pro-Gly-Xaa-Gly(VPGXG)n pentapeptide repeating unit series composition, where Xaa(X) refers to amino acids other than proline (Pro), usually valine (Val, V), alanine Amino acid (Ala, A), glycine (Gly, G) leucine (Leu, L) isoleucine (Ile, I), lysine (Lys, K), phenylalanine (Phe, F) , histidine (His, H) and other amino acid types, but the first 3 and the last amino acid in VPGXG remain unchanged in the repeated sequence with n being 20-120 composed of pentapeptide repeating units in series, and only the first 3 amino acids are changed. The type or ratio of 4 amino acids, (VPGXG) repeating unit n usually ranges from 20 to 120.

[0052] In order to screen out the multi-cloning site of the expression vector that can achieve the requirements of this application, it only acts as a second promoter, and promotes the accumulation of foreign recombinant proteins linked to the start co...

Embodiment 2

[0060] The five different tandem pentapeptide repeating units described above are selected by different restriction sites and connected to a suitable intermediate carrier to artificially synthesize elastin-like polypeptide (ELP)m. ELP[V10G6A4]20, ELP[V20]20, ELP[K2V16F2]20, ELP[I20]20 (SEQ ID NO.1 to SEQ ID NO.4) in Example 1, with every 20 pentapeptide repeating units Four kinds of ELP60 elastin-like polypeptides were formed by connecting enzyme cleavage sites, namely 1. ELP[V30G18A12]60; 2. ELP[V60]60; 3. ELP[K6V48F6]60; 4. ELP[I60]60.

[0061] The fifth ELP[A120]120 (SEQ ID NO.5) is the addition of pflMI (SEQ ID NO.10: the nucleotide sequence is ggccacggcgtgggt) and BglI (SEQ ID NO.11: nucleus The nucleotide sequence is gtgccgggcgggctg) enzyme cutting site step-by-step cloning synthesis.

[0062] Then add R9 and N10 before the N-terminus of the above five ELP elastin-like polypeptides to form the five ELP fusion proteins RELPN specified in this application, and clone the E...

Embodiment 3

[0073] We first used the pET28a vector to construct the above-mentioned pRELPN1, pRELPN2, pRELPN3, pRELPN4, and pRELPN5 vectors, and introduced DH5α competent, shake the bacteria at 37°C overnight, and use the purchased plasmid extraction kit from Sangon Bioengineering (Shanghai) Co., Ltd. Extract the plasmids, insert the exogenous target gene between the NdeI and XhoI restriction sites after the ELP fusion gene of the five vectors to transform the human endostatin gene (mEndostatin, see the patent application number: 201610189012.2), and use The plasmid extraction kit extracts the plasmid containing the ELP fusion gene and the foreign gene mEndostatin gene, and entrusts Nanjing GenScript Biotechnology Co., Ltd. to synthesize the PCR primer (SEQ ID NO.12: cgc catatg cacagccaccgcgacttccag and SEQ ID NO.13: ccg ctcgag cttggaggcagtcatgaagctg), the underlines in the PCR primers refer to the NdeI or XhoI restriction sites respectively, the PCR conditions were pre-denaturation at ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a high-expression recombination protein carrier pRELPN. The high-expression recombination protein carrier pRELPN is artificially synthesized ELP fusion protein(RELPN) consisting of 9 polyarginine (R9)-elastin polypeptide (ELP) n-10 poly asparagine (N10), when multiple clone sites cloned in pronucleus or eukaryotic expression vectors (p) are not directly expressed as exogenous genes, the effect of a second promoter can be achieved. The pRELPN carrier can promote independent high expression of an exogenous target gene behind start cipher ATG cloned behind ELP fusion protein. The fusion protein is seldom expressed, and self expression of hosts of escherichia coli or eukaryocyte and the like can be slightly restrained, so that recombination protein accumulation and high expression of the exogenous target gene can be promoted. The high expression vector pRELPN containing dual promoters is suitable for independent high expression of exogenous genes of antibodies, antigens, enzymes, recombination protein, polypeptide, ELP fusion protein and the like, so as to contribute to solving of the problem of disindustrialization caused by that a common expression vector islow or non in expression on an exogenous gene an exogenous gene or a fusion gene consisting of the exogenous gene and ELP.

Description

technical field [0001] The application belongs to the technical field of genetic engineering, and relates to a high-expression recombinant expression vector pRELPN and its construction method and application. Background technique [0002] Since the Danish geneticist Johansen (W. Johansen 1859~1927) formally proposed the concept of "gene" in his book "Principles of Precision Genetics" in 1909, after the 1950s, with the development of molecular genetics, especially After Watson and Crick proposed the DNA double helix structure, people used various methods to express various biological or human genes in bacteria (Escherichia coli), yeast, plants, insects and cell lines in order to study The function of the gene and the industrial application of the recombinant protein to promote the gene industry. At present, 75% of human-related proteins can be expressed in Escherichia coli, and many proteins have played a huge role in drug therapy. For example, human insulin for diabetes tre...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/63C12N15/66
CPCC07K14/47C12N15/63C12N15/66C07K2319/20Y02A50/30
Inventor 徐根兴
Owner 点斗基因科技(南京)有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More