Recombinant expression carrier and construction method and application thereof
A technology of recombinant vectors and expression vectors, applied in the field of genetic engineering, can solve the problems of low expression, inability to study functions, low expression of recombinant proteins, etc., and achieve the effect of promoting high expression
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0051] Synthetic pentapeptide repeat unit (VPGXG)n of elastin-like polypeptide (ELP)m. According to Val-Pro-Gly-Xaa-Gly(VPGXG)n pentapeptide repeating unit series composition, where Xaa(X) refers to amino acids other than proline (Pro), usually valine (Val, V), alanine Amino acid (Ala, A), glycine (Gly, G) leucine (Leu, L) isoleucine (Ile, I), lysine (Lys, K), phenylalanine (Phe, F) , histidine (His, H) and other amino acid types, but the first 3 and the last amino acid in VPGXG remain unchanged in the repeated sequence with n being 20-120 composed of pentapeptide repeating units in series, and only the first 3 amino acids are changed. The type or ratio of 4 amino acids, (VPGXG) repeating unit n usually ranges from 20 to 120.
[0052] In order to screen out the multi-cloning site of the expression vector that can achieve the requirements of this application, it only acts as a second promoter, and promotes the accumulation of foreign recombinant proteins linked to the start co...
Embodiment 2
[0060] The five different tandem pentapeptide repeating units described above are selected by different restriction sites and connected to a suitable intermediate carrier to artificially synthesize elastin-like polypeptide (ELP)m. ELP[V10G6A4]20, ELP[V20]20, ELP[K2V16F2]20, ELP[I20]20 (SEQ ID NO.1 to SEQ ID NO.4) in Example 1, with every 20 pentapeptide repeating units Four kinds of ELP60 elastin-like polypeptides were formed by connecting enzyme cleavage sites, namely 1. ELP[V30G18A12]60; 2. ELP[V60]60; 3. ELP[K6V48F6]60; 4. ELP[I60]60.
[0061] The fifth ELP[A120]120 (SEQ ID NO.5) is the addition of pflMI (SEQ ID NO.10: the nucleotide sequence is ggccacggcgtgggt) and BglI (SEQ ID NO.11: nucleus The nucleotide sequence is gtgccgggcgggctg) enzyme cutting site step-by-step cloning synthesis.
[0062] Then add R9 and N10 before the N-terminus of the above five ELP elastin-like polypeptides to form the five ELP fusion proteins RELPN specified in this application, and clone the E...
Embodiment 3
[0073] We first used the pET28a vector to construct the above-mentioned pRELPN1, pRELPN2, pRELPN3, pRELPN4, and pRELPN5 vectors, and introduced DH5α competent, shake the bacteria at 37°C overnight, and use the purchased plasmid extraction kit from Sangon Bioengineering (Shanghai) Co., Ltd. Extract the plasmids, insert the exogenous target gene between the NdeI and XhoI restriction sites after the ELP fusion gene of the five vectors to transform the human endostatin gene (mEndostatin, see the patent application number: 201610189012.2), and use The plasmid extraction kit extracts the plasmid containing the ELP fusion gene and the foreign gene mEndostatin gene, and entrusts Nanjing GenScript Biotechnology Co., Ltd. to synthesize the PCR primer (SEQ ID NO.12: cgc catatg cacagccaccgcgacttccag and SEQ ID NO.13: ccg ctcgag cttggaggcagtcatgaagctg), the underlines in the PCR primers refer to the NdeI or XhoI restriction sites respectively, the PCR conditions were pre-denaturation at ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


