The male-specific lethal-related protein msl3 of Diploss chinensis and its encoding gene, dsRNA interference sequence and application
A male and specific technology of Chilo borer, which is applied in the field of agricultural biology, can solve problems such as unreported effects, and achieve the effect of improving mortality
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1 2
[0029] Example 1 Cloning and analysis of the MSL3 gene of Diplosander
[0030] Take 20 mg of Diplodocus chinensis sample and put it in a 1.5 ml non-enzymatic tube, fully grind it with a disposable non-enzymatic grinding rod and liquid nitrogen, and then use an extraction kit to extract total RNA.
[0031] The total RNA extracted above was synthesized into cDNA template using a reverse transcription kit.
[0032] The nucleic acid sequence (SEQ ID NO: 2) of the Male-specific lethal-3 (MSL3) gene was obtained by transcriptome sequencing, and primers were designed to verify the predicted open reading frame. Design and synthesize the following primers:
[0033] Upstream primer sequence MSL3-F: 5'-ATGAAACGGAGCGTTCTTCACC-3';
[0034] Downstream primer sequence MSL3-R: 5'-TTAATGCGATCGAGACATATTGTCTGC-3'.
[0035] The above primers MSL3-F and MSL3-R were used for PCR amplification. After the amplification was completed, after identification by 1% agarose gel electrophoresis, the gel ...
Embodiment 2
[0038] Example 2 Gene silencing efficiency after feeding dsRNA of MSL3 gene and its effect on the growth and development of Diploxinus
[0039] 2.1 Preparation of dsRNA template
[0040] According to the Male-specific lethal-3 (MSL3) gene sequence obtained in Example 1, design specific amplification primers (5'-end plus appropriate restriction sites) for Male-specific lethal-3 ( MSL3) amplification of the dsRNA fragment of the gene, the designed specific primers are as follows:
[0041] Upstream primer sequence ds MSL3-F: tg GAATTC TTTGCCATGTCGCGTGTATG
[0042] Downstream primer sequence ds MSL3-R: tg GGTACC CCCAAAGAAAGCACCACTACG.
[0043] Note: The underlined series is the EcoR I restriction site
[0044] PCR amplification was performed using the primers ds MSL3-F and ds MSL3-R described above. After the amplification is completed, after identification by 1% agarose gel electrophoresis, the gel is cut and the target fragment is purified and recovered by a gel recovery...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 

