Unlock instant, AI-driven research and patent intelligence for your innovation.

The male-specific lethal-related protein msl3 of Diploss chinensis and its encoding gene, dsRNA interference sequence and application

A male and specific technology of Chilo borer, which is applied in the field of agricultural biology, can solve problems such as unreported effects, and achieve the effect of improving mortality

Active Publication Date: 2022-07-08
HUAZHONG AGRI UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] MSL3 has been studied in plants, crustaceans, mammals, and insects, and plays a role in balancing sex differences, but its role in Chilo suppressalis has not been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • The male-specific lethal-related protein msl3 of Diploss chinensis and its encoding gene, dsRNA interference sequence and application
  • The male-specific lethal-related protein msl3 of Diploss chinensis and its encoding gene, dsRNA interference sequence and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1 2

[0029] Example 1 Cloning and analysis of the MSL3 gene of Diplosander

[0030] Take 20 mg of Diplodocus chinensis sample and put it in a 1.5 ml non-enzymatic tube, fully grind it with a disposable non-enzymatic grinding rod and liquid nitrogen, and then use an extraction kit to extract total RNA.

[0031] The total RNA extracted above was synthesized into cDNA template using a reverse transcription kit.

[0032] The nucleic acid sequence (SEQ ID NO: 2) of the Male-specific lethal-3 (MSL3) gene was obtained by transcriptome sequencing, and primers were designed to verify the predicted open reading frame. Design and synthesize the following primers:

[0033] Upstream primer sequence MSL3-F: 5'-ATGAAACGGAGCGTTCTTCACC-3';

[0034] Downstream primer sequence MSL3-R: 5'-TTAATGCGATCGAGACATATTGTCTGC-3'.

[0035] The above primers MSL3-F and MSL3-R were used for PCR amplification. After the amplification was completed, after identification by 1% agarose gel electrophoresis, the gel ...

Embodiment 2

[0038] Example 2 Gene silencing efficiency after feeding dsRNA of MSL3 gene and its effect on the growth and development of Diploxinus

[0039] 2.1 Preparation of dsRNA template

[0040] According to the Male-specific lethal-3 (MSL3) gene sequence obtained in Example 1, design specific amplification primers (5'-end plus appropriate restriction sites) for Male-specific lethal-3 ( MSL3) amplification of the dsRNA fragment of the gene, the designed specific primers are as follows:

[0041] Upstream primer sequence ds MSL3-F: tg GAATTC TTTGCCATGTCGCGTGTATG

[0042] Downstream primer sequence ds MSL3-R: tg GGTACC CCCAAAGAAAGCACCACTACG.

[0043] Note: The underlined series is the EcoR I restriction site

[0044] PCR amplification was performed using the primers ds MSL3-F and ds MSL3-R described above. After the amplification is completed, after identification by 1% agarose gel electrophoresis, the gel is cut and the target fragment is purified and recovered by a gel recovery...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the field of agricultural biotechnology, and in particular relates to the male-specific lethality-related protein MSL3 of Diplodocus chinensis and its encoding gene, dsRNA interference sequence and application. The male-specific lethal-related protein MSL3 of Diploss spp., the amino acid sequence of which is shown in SEQ ID NO.1. The present invention discovers for the first time that the Male-specific lethal-3 (MSL3) gene is involved in the growth and development of S. chinensis, and the lack of its expression can significantly increase the mortality rate of S. spp. larvae and ultimately inhibit the development of the population, which can be used to develop and control S. spp. Diploid insect products.

Description

technical field [0001] The invention belongs to the field of agricultural biotechnology, and in particular relates to the male-specific lethality-related protein MSL3 of Diplodocus chinensis and its encoding gene, dsRNA interference sequence and application. Background technique [0002] Chilo suppressalis belongs to the family Lepidoptera, and is an important polyphagous agricultural pest, which mainly harms rice, water chestnut, corn, wheat and other plants, especially for early planting, densely growing fields and Hybrid rice fields are more harmful. At present, chemical pesticides are the main control methods for the control of Dillite borer. However, the long-term and large-scale use of chemical pesticides has caused problems such as environmental pressure and drug resistance. In order to change this situation, the development and utilization of pollution-free control measures for rice pests that conform to the concepts of environmental protection, health, green ecolog...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/435C12N15/12C12N15/113A01N57/16A01P7/04
CPCC07K14/43563A01N57/16C12N2310/14
Inventor 马伟华金慧慧李昌焱陈浩林拥军
Owner HUAZHONG AGRI UNIV