Pathogenic factor for negatively regulating ustilaginoidea virens spore production, gene and application thereof

A technology of rice smut bacteria and pathogenic factors, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problems of rarely reported pathogenic factors

Active Publication Date: 2020-01-10
CHINA NAT RICE RES INST
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Recently, UvSpo76, Uvt-726, UvSUN2, UvT-B1464R, Uvt-1241 UvHOG1, UvPRO1 have been clarified through the forward genetics method of T-DNA random insertion and the reverse genetics method of knocking out target genes such as homologous recombination. The biological functions of , Uvt3277 and UvSLT2 genes have proved that these genes are positively involved in the spore differentiation, vegetative hyphal growth and pathogenicity of rice smut, but there are few reports of pathogenic factors that negatively regulate sporulation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pathogenic factor for negatively regulating ustilaginoidea virens spore production, gene and application thereof
  • Pathogenic factor for negatively regulating ustilaginoidea virens spore production, gene and application thereof
  • Pathogenic factor for negatively regulating ustilaginoidea virens spore production, gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Identification and knockout of UvPSR1 gene in rice false smut.

[0027] The amino acid sequence of rice smut UvPSR1 protein is shown in SEQ ID No.1, and the gene sequence (CDS sequence) of rice smut UvPSR1 gene is shown in SEQ ID No.2. The rice false smut UvPSR1 gene knockout vector was constructed by homologous recombination strategy. The knockout strategy is shown as figure 1 shown.

[0028] Knockout vector construction was performed as follows:

[0029] The UvPSR1 gene is 3556bp in length (sequence shown in SEQ ID No.3, including CDS sequence and some non-coding region sequences), which was replaced by the hygromycin B gene by homologous recombination to obtain the UvPSR1 knockout mutant . Specific steps are as follows:

[0030] Using the genome of the wild strain HWD of rice mistletoe (from Huang Junbin's laboratory of Huazhong Agricultural University) as a template, PCR amplified the upstream 1069bp of the UvPSR1 gene (the gene fragment is named UvPSR1-5') and...

Embodiment 2

[0044] Identification of UvPSR1 gene knockout mutants of rice smut.

[0045] 1. Genomic DNA level identification

[0046] Extract the transformant genome, use the verified primers Uvpsr1-3tR (5'-CGGGCTCACTCCTGATTCTT-3'), and p821-5F (GTGGTGTAAACAAATTGACGCTTAG) to amplify the recombined fragment, and the detection system is:

[0047]

[0048] The reaction conditions are:

[0049] Pre-denaturation at 95°C for 30s;

[0050] Denaturation at 95°C for 7s, annealing at 63°C for 20s, extension at 72°C, the extension time was determined according to the size of the amplified fragment (30s / kb), a total of 34 cycles, and the annealing temperature decreased by 0.2°C for each cycle;

[0051] Extend at 72°C for 2 min.

[0052] If the amplification result is positive, it is a knockout mutant. A total of 7 mutant strains were identified, and the knockout mutants were named ΔUvpsr1-1, 2, 3, 7, 8, 9, and 13. Since the phenotypes of the knockout mutant transformants were consistent, ΔUvpsr1...

Embodiment 3

[0061] Acquisition of UvPSR1 deletion mutant complementation vector and complementation strain.

[0062] In order to verify that the phenotype of the mutant is caused by the deletion of UvPSR1, we constructed the complementary vector UvPSR1-C, using the wild-type HWD genome as a template, and using primers UvPSR1-F / R to amplify the full length of the UvPSR1 gene, using T4 Ligase ligated to pFGL820 (addgene ID: 58221) vector linearized with endonucleases EcoR1 and Xba1.

[0063] UvPSR1-F: 5'-CGGAATTCCGTCGGAGGCAACATTCAAG-3';

[0064] UvPSR1-R: 5'-GCTCTAGATCCTCGCAAATCCCCACTCT-3'.

[0065] The completed complementation vector was transformed into the knockout mutant ΔUvpsr1-1 strain, which was named Uvpsr1-C. QRT-PCR detection showed that UvPSR1 gene was normally expressed in the complementation mutant.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a pathogenic factor for negatively regulating ustilaginoidea virens spore production, a gene and an application thereof. An amino acid sequence is shown as SEQ ID No. 1, and the gene sequence is shown as SEQ ID No. 2. The researches find that the fungus pathogenic gene ustilaginoidea virens UvPSR1 derived from ustilaginoidea virens plays an important role in fungus vegetative growth, spore yield, infected hypha formation and pathopoiesis process, and the gene or protein encoded by the gene can be used as a target for designing and screening antifungal drugs.

Description

technical field [0001] The invention relates to the technical field of rice false smut disease prevention and control, in particular to a pathogenic factor, gene and application that negatively regulates spore production of rice false smut. Background technique [0002] Rice false smut is a disease of rice that has gradually increased in incidence in recent years, and has an important impact on rice yield and quality. The disease is widely distributed in major rice producing areas, and occurs heavily in Asian countries such as China, Japan, India and the Philippines. In my country, affected by factors such as climate change, increased fertilizer application, and single species, the disease presents a trend of increasing year by year and gradually expanding. The disease is caused by the infection of Ustilaginoidea virens (Ustilaginoidea virens) of the Ascomycotina subphylum Ergotaceae. It infects the uneared rice flower organs and forms dark green rice balls on the ears in t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K14/37C12N15/31C12N15/82A01H5/00A01H6/46A01N57/16A01P3/00
CPCA01N57/16C07K14/37C12N15/8218C12N15/8282
Inventor寇艳君熊萌时焕斌邱结华
OwnerCHINA NAT RICE RES INST