A genetically engineered strain of Saccharomyces cerevisiae and its construction method and application

A technology of genetically engineered bacteria and Saccharomyces cerevisiae, applied in the field of genetically engineered bacteria of Saccharomyces cerevisiae and its construction, can solve the problems of weakening the amount of biofilm with flocculation characteristics, large amount of biofilm, strong flocculation characteristics, etc. Increased and reduced flocculation properties

Active Publication Date: 2021-06-25
NANJING TECH UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Purpose of the invention: In order to solve the problems of strong flocculation characteristics of existing Saccharomyces cerevisiae strains and a large amount of biofilm in immobilized fermentation, the first aspect of the present invention provides a strain of Saccharomyces cerevisiae genetically engineered bacteria that knocks out the FLO8 gene, which can directional weaken its Flocculation characteristics and the amount of biofilm in immobilized fermentation; the second aspect provides a method for constructing a Saccharomyces cerevisiae genetically engineered bacterium that knocks out the FLO8 gene; Applications

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A genetically engineered strain of Saccharomyces cerevisiae and its construction method and application
  • A genetically engineered strain of Saccharomyces cerevisiae and its construction method and application
  • A genetically engineered strain of Saccharomyces cerevisiae and its construction method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] The primers used in the following examples are as follows:

[0030] AATGAAAGAATCACGGCACG(FLO8-up-F)

[0031] ggtattctgggcctccatgtcCTAACGTCAACTCACCGTG(FLO8-up-R)

[0032] aatgctggtcgctatactgACCTAGATAGAGACAAAAGGCC(FLO8-down-F)

[0033] CGTAGTGGGTTGCATTGGATA(FLO8-down-R)

[0034] ACACGGTGAGTTGACGTTAGgacatggaggcccagaatac (AurR-F)

[0035] GCCTTTGTCTCTATCTAGGTcagtatatagcgaccagcattc (AurR-R)

[0036] 1. Construction of FLO8 gene knockout fragment

[0037] (1) Using the genomic DNA of the original Saccharomyces cerevisiae S288c as a template, the upstream and downstream homology arm amplification fragments of the FLO8 gene were amplified by ordinary PCR (upstream homology arm amplification primer sequence FLO8-up-F , FLO8-up-R are respectively shown in SEQ ID NO:4 and SEQ ID NO:5; downstream homology arm amplification primer sequences FLO8-down-F, FLO8-down-R are respectively shown in SEQ ID NO:6 and SEQ ID NO:6 and SEQ ID NO:5 ID NO: 7); the PCR reaction system is shown...

Embodiment 2

[0060] (1) Take 100 μL of glycerol bacteria S288c (original bacteria) and S288c-△FLO8 (knockout bacteria constructed in Example 1) and add them to 5 mL of sterilized YPD liquid medium for overnight culture and activation;

[0061] (2) According to the inoculation ratio of 10% by volume, transfer the bacterial liquid in step (1) to 100 mL of YPD liquid medium, and continue to cultivate at 30°C and 200 r / min until the OD600 of the bacterial liquid is between 0.8 and 1.2;

[0062] (3) Take 2 mL of the bacterial solution to measure the absorbance value at OD600, and dilute the bacterial solution with sterilized YPD liquid medium so that the OD600 of the diluted bacterial solution is 0.01;

[0063] (4) Take 200 μL of the diluted bacterial solution and add it to a 96-well plate, and use LB liquid medium as a control, and incubate at 37°C for 24 hours;

[0064] (5) Pour out the 96-well plate bacterial solution, buffer with 0.01MPBS buffer 3 times, and pat dry;

[0065] (6) Add 200 μ...

Embodiment 3

[0068] (1) Add 100 μL of glycerol bacteria S288c and S288c-△FLO8 into sterilized 5 mL YPD liquid medium for overnight culture and activation;

[0069] (2) According to the inoculation ratio of 10% by volume, transfer the bacterial liquid in step (1) to 100 mL of YPD liquid medium, and continue to cultivate at 30°C and 200 r / min until the OD600 of the bacterial liquid is between 0.8 and 1.2;

[0070] (3) Transfer the seed solution of step (2) to 100 mL of fermentation medium, which is divided into two types: free fermentation and immobilized fermentation. When immobilized fermentation is carried out, cotton fiber material is added as immobilized material. Add 4g of cotton fiber medium to the medium; ferment at 35°C and 200r / min, and the reaction ends after the glucose is exhausted. Use a spectrophotometer to measure the amount of residual sugar in the fermentation broth at each time period, and use a high-efficiency gas chromatograph to measure the alcohol content in the ferment...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a genetically engineered strain of Saccharomyces cerevisiae with a knockout FLO8 gene, belonging to the field of microbial genetic engineering. The invention also discloses a method for constructing a genetically engineered bacterium. The FLO8 gene knockout component is constructed by using the aureobasidin resistance marker AurR gene, and the Saccharomyces cerevisiae yeast strain is successfully transformed. The invention further discloses the application of the genetically engineered bacteria in the immobilized fermentation production model. Compared with the original strain, the present invention obviously weakens the flocculation property of Saccharomyces cerevisiae in free fermentation, and in immobilized fermentation, the formed biofilm is reduced, the adhesion is reduced, and the free cells are obviously increased.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a Saccharomyces cerevisiae genetic engineering strain knocking out the FLO8 gene and its construction method and application. Background technique [0002] Biofilm, also known as biofilm, is a biological aggregate composed of microbial cells and their secreted extracellular matrix. The microbial clusters and their secreted polysaccharides, proteins, fatty acids, etc. form a film-like structure and attach to the surface of the carrier. The existence of biofilm not only creates a stable internal environment for the life activities of cells as a barrier, mediates the connection between cells and cells, and between cells and substrates, but also undertakes material transport, information transmembrane transmission and energy conversion. These functions are all determined by the structure of the biofilm. Biofilm is also used as an important industrial applicat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N1/19C12N15/81C12N15/90C12N15/31C12P7/06C12R1/865
CPCC07K14/395C12N15/81C12N15/905C12P7/06Y02E50/10
Inventor应汉杰张德力陈勇奚迅丁赛俞莹王芳娟梁偲策欧阳平凯
OwnerNANJING TECH UNIV