Saccharomyces cerevisiae gene engineering bacteria for knocking out FBP1 gene and construction method and application thereof

A technology of genetically engineered bacteria and Saccharomyces cerevisiae strains, applied in the field of genetic engineering, can solve problems such as affecting fermentation speed, hindering mass transfer, and not having obvious advantages in fermentation

Inactive Publication Date: 2019-04-16
NANJING UNIV OF TECH
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

If the amount of biofilm is too small, the fermentation advantage is not obvious. If the amount of biofilm is too large, it will hinder mass transfer and thus affect the fermentation speed.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Saccharomyces cerevisiae gene engineering bacteria for knocking out FBP1 gene and construction method and application thereof
  • Saccharomyces cerevisiae gene engineering bacteria for knocking out FBP1 gene and construction method and application thereof
  • Saccharomyces cerevisiae gene engineering bacteria for knocking out FBP1 gene and construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1: Construction of FBP1 gene knockout Saccharomyces cerevisiae strain.

[0024] The primers used in the following examples are as follows:

[0025] AACGCTCTACCAACTGAGC (SEQ ID NO: 4, FBP1-up-F)

[0026] ATTCTGGGCCTCCATGTCCGTCTGTAATTGCACTACTTGT (SEQ ID NO:5, FBP1-up-R)

[0027] AAGTAGTGCAATTACAGACGGACATGGAGGCCCAGAATAC (SEQ ID NO: 6, AurR-F)

[0028] ACTGTGACTTGCCAATATGGCAGTATAGCGACCAGCATTC (SEQ ID NO:7, AurR-F)

[0029] ATGCTGGTCGCTATACTGCCATATTGGCAAGTCACAGTAG (SEQ ID NO: 8, FBP1-down-F)

[0030] GCGAATTCATGTAGATCGCG (SEQ ID NO:9, FBP1-down-F)

[0031] ATTCTTAGTAGTCGCGGTCG (SEQ ID NO: 10, YZ-F)

[0032] CAATGATGTGCAAGAACCCT (SEQ ID NO: 11, YZ-R)

[0033] 1. Construction of FBP1 knockout components.

[0034] (1) Utilize common PCR amplification to obtain the upper and lower homology arm amplification fragments of the yeast FBP1 gene (the upper homology arm amplification primer sequences FBP1-up-F, FBP1-up-R such as SEQ ID NO: 4 and SEQ ID NO: ID NO: shown ...

Embodiment 2

[0050] (1) Take 100 μL of glycerol bacteria S288c (starting bacteria) and S288c-FBP1 (knockout bacteria constructed in the present invention) and add them into sterilized 5mL YPD liquid medium for overnight culture and activation;

[0051] (2) According to the inoculation ratio of 10% by volume, transfer the bacterial solution in step (1) to 100 mL of YPD liquid medium, and continue to cultivate at 30° C. at 200 r / min until the OD600 of the bacterial solution is between 0.8 and 1.2;

[0052] (3) Take 2 mL of the bacterial solution to measure the absorbance value at OD600, and dilute the bacterial solution with sterilized YPD liquid medium so that the OD600 of the diluted bacterial solution is 0.01;

[0053] (4) Take 200 μL of bacterial solution and add it to a 96-well plate, and LB liquid medium as a control, and incubate at 37°C for 24 hours;

[0054] (5) Pour out the bacterial solution from the 96-well plate, buffer with pure water for 3 times, and pat dry;

[0055] (6) Add...

Embodiment 3

[0058] (1) Add 100 μL of glycerol bacteria S288c and S288c-FBP1 into sterilized 5 mL YPD liquid medium for overnight culture and activation;

[0059] (2) According to the inoculation ratio of 10% by volume, transfer the bacterial solution in step (1) to 100 mL of YPD liquid medium, and continue to cultivate at 30° C. at 200 r / min until the OD600 of the bacterial solution is between 0.8 and 1.2;

[0060] (3) Transfer the seed liquid of step (2) to 100mL fermentation medium, which is divided into two types: free fermentation and immobilized fermentation, and immobilized fermentation is added with cotton fiber material as immobilized material, at 35°C 200r / min Fermentation, the reaction ends after the glucose is exhausted, the residual sugar content of the fermentation broth is measured by a spectrophotometer, and the alcohol content in the fermentation broth is measured by a high-efficiency gas chromatograph;

[0061] Among them, the formula of the fermentation medium is as foll...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses saccharomyces cerevisiae gene engineering bacteria for knocking out an FBP1 gene, and belongs to the field of microorganism genetic engineering. According to the method, aureobasidin resistance identifier AurR is used for constructing an FBP1 gene knockout assembly and successfully converting a saccharomyces cerevisiae strain. The invention further discloses a constructingmethod of the gene engineering bacteria and further discloses the application of the gene engineering bacteria in immobilization fermentation production models. The gene engineering bacteria have theadvantages that the flocculating characteristics of the saccharomyces cerevisiae in free fermentation is significantly reduced, biofilms formed in the immobilization fermentation are reduced, the adhesive is reduced, and the number of the free cell is significantly increased.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a Saccharomyces cerevisiae genetically engineered bacterium for knocking out the FBP1 gene and its construction method and application. Background technique [0002] Biofilm is a biological aggregate composed of microbial cells and their secreted extracellular matrix, which has attracted people's attention for its unique micro-colony morphology and high environmental resistance. As an important industrial application of biofilm, the biofilm formed by cells in the immobilized fermentation process shows higher substrate tolerance and faster fermentation efficiency for fermentation production after immobilized cell membrane formation. The continuous fermentation process and the substantial improvement of fermentation efficiency. Under normal conditions, it takes about 8 hours for conventional free cells to ferment 50g of glucose, while our immobilized cells ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/19C12N15/81C12P7/06C12R1/865
CPCC07K14/395C12N15/81C12P7/06Y02E50/10
Inventor 应汉杰奚迅陈勇刘娜任培芳孙文俊
Owner NANJING UNIV OF TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap