1, 4-alpha-glucan branching enzyme, gene thereof, and engineering bacteria containing gene and application of engineering bacteria

A technology of starch branching enzyme and starch processing, which is applied in the direction of genetic engineering, application, plant gene improvement, etc., can solve the problems of limited activity and catalytic characteristics of starch branching enzyme, and achieve the effect of wide branching chain distribution characteristics and high catalytic efficiency

Active Publication Date: 2020-02-07
NANJING AGRICULTURAL UNIVERSITY
View PDF15 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are few starch branching enzymes with independent intellectual property rights in China, and the application of the reported starch branching enzymes is l

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • 1, 4-alpha-glucan branching enzyme, gene thereof, and engineering bacteria containing gene and application of engineering bacteria
  • 1, 4-alpha-glucan branching enzyme, gene thereof, and engineering bacteria containing gene and application of engineering bacteria
  • 1, 4-alpha-glucan branching enzyme, gene thereof, and engineering bacteria containing gene and application of engineering bacteria

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0033] Example 1 Expression, Purification and Activity Determination of Starch Branching Enzyme

[0034] 1.1 PCR amplification of starch branching enzyme gene

[0035] Refer to the Aquabacterium sp.strain A7-Y genome sequence and combined with NCBI genome information for ORF prediction, design the starch branching enzyme gene primers with the full-length sequence, and use the genomic DNA of A7-Y bacteria (CCTCC NO: M2012316) as a template for starch branching PCR amplification of the full length of the enzyme gene yields the full length sequence of the starch branching enzyme gene. The full length of the gene (from the start codon to the stop codon) is 1881 bp, the G+C content is 68.4%, the gene sequence is SEQ ID NO. 1, encoding 626 amino acids, and its amino acid sequence is SEQ ID NO.2. The primers used are F and R, see the results figure 1 . Specific process reference figure 2 .

[0036] F: GGGAATTCCATATGGTGCTGAGCGATCACGACA (Nde I) (SEQ ID NO.3)

[0037] R: CCGGAATTCTTAATGATGA...

Example Embodiment

[0045] Example 2. Study on the enzymatic properties of starch branching enzyme AqGBE

[0046] 3.1 The influence of temperature on enzyme activity

[0047] Determination of the optimum reaction temperature: The activity of the recombinase is measured at different temperatures (20℃, 30℃, 40℃, 45℃, 50℃, 55℃, 60℃, 70℃) and pH 7.0, the highest Enzyme activity is set to 100% ( Figure 4 a). Determination of thermal stability: Keep the recombinant enzyme at 20℃, 30℃, 40℃, 45℃, 50℃, 60℃, 70℃, and pH 7.0 for 1 hour, then quickly cool on ice, and measure the residual enzyme activity respectively. Take the unwarmed enzyme activity as 100% ( Figure 4 b). It was determined that the optimal reaction temperature of the starch branching enzyme was 40°C, and it remained relatively stable between 20°C and 50°C.

[0048] 3.2 The influence of pH on enzyme activity

[0049] Determination of the optimal reaction pH: Determine the activity of recombinant starch branching enzyme at different pH values ​​...

Example Embodiment

[0054] Example 3. Preparation of multi-branched modified starch using starch branching enzyme AqGBE

[0055] Prepare 10% potato starch in a boiling water bath for 30 minutes to fully gelatinize, add starch branching enzyme AqGBE at an amount of 500 U / kg starch after cooling, react at 40°C for 10 minutes and 30 minutes, and terminate the reaction in a boiling water bath. The prepared enzyme-treated starch was then added with isoamylase (1U / mg starch) for debranching reaction at 40°C for 24 hours, and the reaction was terminated by boiling water bath. High performance anion exchange chromatography (ICS-5000, DIONEX, USA) was used to analyze the degree of polymerization of branched chains. The results showed that the content of branch chains with high degree of polymerization of starch increased (DP> 25), 30min treatment of starch low polymerization degree branch chain content increased (DP <7) (Table 2). The results show that starch branching enzyme AqGBE acts on starch to produce...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a 1, 4-alpha-glucan branching enzyme, a gene thereof, and engineering bacteria containing the gene and an application of the engineering bacteria. The invention provides the gene of the 1, 4-alpha-glucan branching enzyme. The overall length of the gene is 1881bp, G+C content is 68.4%, 626 amino acids are coded, the nucleotide sequence of the gene is as shown in SEQ ID NO.1,and the amino acid sequence of coded protein is as shown in SEQID NO.2. A recombinant 1, 4-alpha-glucan branching enzyme obtained through an engineering bacterium strain constructed through the geneuses potato starch as an activity measuring substrate, and through iodine liquid detection, the specific activity is 2784U/mg. The 1, 4-alpha-glucan branching enzyme produced from the gene can be usedfor starch modification, including preparation of slowly digestible starch or resistant starch, preparation of high-branching-degree modified starch having gel characteristic optimization or aging resistant characteristic, preparation of cold water soluble starch and the like.

Description

technical field [0001] The invention belongs to the field of applied industrial microorganisms, and discloses a starch branching enzyme and its gene, an engineering bacterium containing the gene and its application in starch modification and high-branching starch preparation. Background technique [0002] Starch is one of the most abundant polymers on earth. Starch granules are mainly composed of amylose and amylopectin. The content and structure of amylose and amylopectin have a great influence on the function of starch. Specificity plays a decisive role. At present, the structure of starch is changed by physical, chemical or biological methods, and then the characteristics of starch are improved, so as to be applied in the field of functional food preparation and other fields. Starch branching enzyme (1,4-α-glucan branching enzyme; EC2.4.1.18) belongs to a class of glycosyltransferases of glycoside hydrolase family 13 (GH13), which catalyzes α-1,4- The cleavage of glycos...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/56C12N9/10C12N15/70C12N1/21C12P19/16C12P19/04C12R1/19
CPCC12N9/107C12P19/16C12P19/04C12Y204/01018
Inventor 崔中利李周坤陈晓培夏丞垚黄彦
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap