Anti-IL-1beta (anti-interleukin-1beta) antibody as well as medicine composition and application thereof
An antibody drug, antibody technology, applied in the field of immunology, can solve the problem of inability to activate intracellular related signaling pathways
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example 1
[0177] Preparation Example 1: Fusion proteins human IL-1β-His, IL-1R1(1-332)-His, IL-1β-hFc and human IL-1β- Preparation of His-Bio
[0178] The protein sequences of human IL-1β (Genbank ID: NP_000567.1) and IL-1R1 (Genbank ID: NP_000868) were searched through the NCBI GenBank protein database. The amino acid sequences of human IL-1β and IL-1R1 were fused with the His tag sequence and the human IgG Fc purification tag sequence respectively; the above-mentioned fusion proteins were abbreviated as human IL-1β-His and IL-1R1(1-332) respectively -His, IL-1β-hFc.
[0179] The quality of protein samples was identified by SDS-PAGE.
[0180] use Sulfo-NHS-LC-Biotinylation Kit (Thermo scientific) was used to prepare biotinylated-conjugated human IL-1β-His protein samples (referred to as human IL-1β-His-Bio for short); refer to the instructions of the kit for specific preparation methods.
[0181] The above-mentioned fusion protein prepared was used in the following examples. ...
Embodiment 1
[0182] Example 1: Preparation of anti-IL-1β murine antibody 3H6
[0183] 1. Preparation of hybridoma cell line LT010
[0184] BALB / C mice (purchased from Guangdong Medical Experimental Animal Center) were immunized with human IL-1β-his as an antigen, and splenocytes from the immunized mice were fused with mouse myeloma cells to form hybridoma cells. Using IL-1β-His-Bio as an antigen, the hybridoma cells were screened by ELISA method to obtain hybridoma cells capable of secreting antibodies specifically binding to IL-1β-His-Bio. For the hybridoma cells screened by ELISA, the hybridoma cell line that can secrete the monoclonal antibody that can compete with the receptor IL-1R1(1-332)-His to bind to IL-1β-His-Bio was screened by competitive ELISA, and passed Stable hybridoma cell lines were obtained by limiting dilution method. The method of hybridoma cell preparation refers to the established methods (for example, Stewart, S.J., "Monoclonal Antibody Production", in Basic Met...
Embodiment 2
[0189] Example 2: Sequence Analysis of Anti-IL-1β Antibody 3H6
[0190] The mRNA was extracted from the LT010 cell line cultured in Example 1 according to the method of Cultured Cell Bacteria Total RNA Extraction Kit (Tiangen, Cat. No. DP430). According to Invitrogen III First-StrandSynthesis System for RT-PCR Kit Instructions Synthesize cDNA and perform PCR amplification. The PCR amplification product was directly cloned by TA, and the specific operation was carried out referring to the instructions of the pEASY-T1 Cloning Kit (Transgen CT101) kit.
[0191] The products of TA clones were directly sequenced, and the sequencing results were as follows:
[0192] Nucleic acid sequence encoding the heavy chain variable region of antibody 3H6: (354bp)
[0193] CAGGTGACCCTGAAGGAGAGCGGACCAGGAATCCTGCAGCCTAGCCAGACACTGAGCCTGACTTGCAGCTTCAGCGGCTTCAGCCTGAGCACAAGCGGAATGGGCGTGTCTTGGATCAGGCAGCCATCAGGAAAGGGACTCGAGTGGCTGGCTCACATCTACTGGGACGACGACAAGCGGTACAACCCCTCCCTGAAGAGCAGGCTGACCATCAGCAA...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


