Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of OsPTP1 in efficient plant phosphorus breeding

An efficient and versatile technology, applied in the field of plant genetic engineering, can solve the problems of insufficient phosphorus availability, low phosphorus content, and affecting plant growth and development.

Active Publication Date: 2020-03-27
ZHEJIANG UNIV
View PDF8 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, the low content of free phosphorus in the soil causes most plants to have insufficient phosphorus available, which affects plant growth and development (Wu et al., 2013)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of OsPTP1 in efficient plant phosphorus breeding
  • Application of OsPTP1 in efficient plant phosphorus breeding
  • Application of OsPTP1 in efficient plant phosphorus breeding

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] Example 1. Research on the interaction of OsPTP1 with OsPT2 and OsPT8:

[0064] Firstly, a protein phosphatase OsPTP1 capable of interacting with OsPT8 was screened by yeast two-hybrid. Its genome sequence is 3892bp (SEQ ID No. 1) and encodes a 290 amino acid protein (SEQ ID No. 2).

[0065] Then further design confirmed that in addition to OsPT8, OsPT2 can also interact with OsPTP1. By analyzing the protein structure of OsPTP1, it was found that it consists of 36 amino acids at the N-terminus and 254 amino acids at the C-terminal PP2C phosphatase domain ( figure 1 A). In order to clarify the subdomains that interact with OsPT2 and OsPT8, the two subdomains of OsPTP1 were truncated, and it was confirmed by yeast two-hybrid experiments that OsPTP1 interacted with OsPT2 and OsPT8 through its N-terminal 36 amino acids ( figure 1 B). Subsequently, the interaction between OsPTP1 and OsPT8 was further clarified by in vivo Co-IP experiments ( figure 1 C and 1D).

Embodiment 2

[0066] Example 2. OsPTP1 is verified to have protein phosphatase activity in vitro:

[0067] In order to clarify that OsPTP1 has protein phosphatase activity, it was prokaryotically expressed and purified. Using the wild-type cDNA as a template, the full-length coding sequence of OsPTP1 was amplified with OsPTP1-specific primers, and the target fragment size was 873bp. The amplified target fragment was double-digested with BamH I and Sal I, and ligated into the pGEX4T-1 vector after the same digestion. In order to verify that OsPTP1 has PP2C phosphatase activity, one of the Mg 2+ / Mn 2+ Mutation of the ion binding site (specifically, aspartic acid at the 240th amino acid position of OsPTP1 protein is mutated to asparagine). The pGEX4T-1 vector was constructed by the same ligation method. The primers used are as follows:

[0068] OsPTP1 full-length primer:

[0069]The upstream primer is: CGGGATCCATGGCTGGCAAGGAAATCTACC

[0070] The downstream primer is: GCGTCGACGCAGAGGAAT...

Embodiment 3

[0075] Example 3, construction of OsPTP1-GUS fusion gene vector and GUS staining

[0076] OsPTP1p:OsPTP1:GUS vector construction: use the wild-type Nipponbare genome as a template to amplify the OsPTP1 promoter, 5'UTR and the whole genome sequence (excluding the terminator, 6408bp), use Sal I and BamH I to digest, and ligate into pBI-GUS-PLUS vector after the same digestion; get OsPTP1p:OsPTP1:GUS vector.

[0077] The primer information is as follows:

[0078] Upstream primer: GCGTCGACTAAACGACGGTAAAAATCCCTAAT

[0079] Downstream primer: CGGGATCCTGCAGAGGAATTTTACAACGATGC

[0080] After being verified by sequencing, it was integrated into the wild-type Nipponbare genome through Agrobacterium infection.

[0081] GUS staining and microscopic observation

[0082] Soak the roots, rhizome junctions, stems, leaves, flowers and other organs of T1 generation transgenic seedlings in the GUS dye solution (recipe as shown in Table 1), vacuumize at room temperature for 10 minutes, and th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of plant genetic engineering, and particularly relates to a rice OsPTP1 (Phosphate Transporter Phosphatase 1) gene cloned by a reverse genetics approach, and the function of the gene is identified by an overexpression technology and a gene editing technology. The gene OsPTP1 is used for improving the absorption, transport or utilization of crops to phosphorus, sothat efficient phosphorus breeding is realized.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering. Specifically, the present invention relates to a rice OsPTP1 (Phosphate Transporter Phosphatase 1) gene cloned by a reverse genetics approach, and the function of the gene is identified through overexpression technology and gene editing technology; Phosphorus uptake, use efficiency and yield. Background technique [0002] Phosphorus is an important nutrient element required for plant growth and development. Phosphorus mainly exists in the form of pentavalent phosphate in soil, which combines with metal ions (such as Fe, Ca, etc.), resulting in an ion state phosphorus content of less than 10 μm (Chiou & Lin, 2011). Therefore, the low content of free phosphorus in the soil leads to insufficient phosphorus availability for most plants, which affects plant growth and development (Wu et al., 2013). Plants absorb external free phosphate through phosphate transporter (Phosphate Transporter; P...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/55C12N15/82A01H5/00A01H6/46
CPCC12N9/16C12N15/8243
Inventor 毛传澡杨健杨支力徐纪明吴忠长
Owner ZHEJIANG UNIV