Primer, probe and reagent kit for quick and quantitative detection by AR-V7 fluorescent qRT-PCR method

An AR-V7, detection reagent technology, applied in the determination/inspection of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problem of not being able to fully reflect the disease state of patients, requiring high freshness of whole blood samples, The high heterogeneity of tumor cells can reduce the risk of contamination or errors, ensure reliable detection results, and shorten the experimental period.

Active Publication Date: 2020-03-27
3D BIOMEDICINE SCI & TECH CO LTD
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] There are currently many problems in the follow-up detection of AR-V7 using CTC. The main problems are as follows. One is that it requires high freshness of whole blood samples, and the samples must be separated from CTC within a few hours of collection; the other is that Due to the high degree of heterogeneity of tumor cells, the isolation of CTCs can only obtain part of the tumor cells, which cannot fully reflect the patient's disease state. There may be only 6-7, or even not separated at all

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer, probe and reagent kit for quick and quantitative detection by AR-V7 fluorescent qRT-PCR method
  • Primer, probe and reagent kit for quick and quantitative detection by AR-V7 fluorescent qRT-PCR method
  • Primer, probe and reagent kit for quick and quantitative detection by AR-V7 fluorescent qRT-PCR method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061] Example 1 Extraction of exosomes

[0062] Materials: 8 cases of EDTA tubes were used to collect plasma samples, and exosomes were prepared using automatic exosome extraction reagents.

[0063] Experimental steps:

[0064] 1. Plasma sample pretreatment

[0065] Take a plasma sample of 16.000 g, centrifuge at 4 °C for 10 min, and take 1 mL of the supernatant for use;

[0066] 2. The formula of exosome automatic extraction reagent is as follows:

[0067] (1) Magnetic bead suspension, mainly carboxyl magnetic beads coated with 1 mg / mL CD63 antibody;

[0068] (2) Washing solution, mainly 0.01 M phosphate buffer solution of 0.02 mg / mL bovine serum albumin;

[0069] (3) Eluent, mainly 0.01 M phosphate buffer;

[0070] 3. The parameter setting of exosome automatic extraction equipment is as follows:

[0071]

[0072] 4. The specific operation process is as follows:

[0073] (1) Take a 96-well deep-well plate, add 1 mL of plasma from 8 samples in sequence to well 1, an...

Embodiment 2

[0080] Example 2 Extraction of exosome nucleic acid

[0081] Materials: Take 100 μL of phosphate buffer solution containing exosomes and magnetic beads prepared in Example 1, use the exosome nucleic acid extraction reagent of the present invention, and use an automatic nucleic acid purifier to prepare exosome RNA;

[0082] experiment process:

[0083] The exosome nucleic acid extraction reagent provided by the present invention uses the KY-32A automated nucleic acid extraction workstation of Kangyu Biotechnology to extract exosome RNA, and the reagent addition method is as follows:

[0084] Add 10 μL of exosome resuspension, 800 μL of solution I, and 10 μL of solution II to the 8 wells in the first column of the 96-deep well plate. Add 40 μL solution III to the 8 wells in column 2, add 300 μL washing solution A to the 8 wells in column 3, add 400 μL washing solution B to the 8 wells in column 4, and add 400 μL washing solution B to the 8 wells in column 5. Add 500 μL of wash...

Embodiment 3

[0092] Example 3 Screening and optimization of AR-V7 primer pair and AR primer pair

[0093] The primer sequences for detecting AR-V7 and AR disclosed by the present invention are as follows:

[0094] AR-V7 forward primer: CAGGGATGACTCTGGGAGAAA;

[0095] AR-V7 reverse primer: AGTCAGCCTTTTCTTCAGGGTC;

[0096] AR forward primer: TGCTCAAGACGCTTCTACCAG;

[0097] AR reverse primer: AGTGAACTGATGCAGCTCTC;

[0098] The primer sequences for detecting AR-V7 and AR reported in the literature (AR-V7 and resistance to enzalutamide and abiraterone in prostate cancer. N Engl J Med 2014;371:1028-38) are as follows:

[0099] AR-FL forward primer: CAGCCTATTGCGAGAGAGCTG;

[0100] AR-FL reverse primer: GAAAGGATCTTGGGCACTTGC;

[0101] AR-V7 forward primer: CCATCTTGTCGTCTTCGGAAATGTTA;

[0102] AR-V7 reverse primer: TTTGAATGAGGCAAGTCAGCCTTTCT;

[0103] The comparison test of the primer pair was performed by using the exosomal RNA in the culture supernatant of 22RV1 cells by ultra-high speed c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer and probe for detecting AR-V7 and ARE, and provides a reagent kit for detecting AR-V7 and AR based on the primer and probe. The reagent kit comprises an exosome extraction reagent, an exosome nucleic acid extraction reagent, an AR-V7 detection reagent by a qRT-PCR method. Samples for the reagent kit are broad and easy to obtain, the success rate for preparing exosomes is high, exosome nucleic acid is automatically extracted, the required operation time is short, and the operation errors are low. Besides, according to an one-step method qRT-PCR reagent providedby the invention, the operation flows are simplified, the experiment period is shortened, the efficiency is improved, and the sample contamination or detection fault risks in the middle process can also be reduced.

Description

technical field [0001] The invention relates to molecular biology detection technology, in particular to a primer, probe and kit for rapid quantitative detection of human AR-V7 fluorescence qRT-PCR method. Background technique [0002] Prostate cancer is a common malignancy and the second leading cause of cancer death in men. In recent years, the incidence of prostate cancer in my country has shown a rapid upward trend year by year, from 5.8 / 100,000 in 2004 to 8 / 100,000 in 2009. Due to the relatively backward screening of prostate cancer-susceptible populations in my country, advanced prostate cancer accounts for about 70% of newly diagnosed prostate cancer, and the proportion of newly diagnosed advanced prostate cancer in my country is much higher than that in European and American countries (20-30%). Androgen deprivation therapy (Androgen deprivation therapy, ADT) is the most important treatment for this kind of prostate cancer patients. Although prostate cancer is contr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6851C12Q1/6806C12N15/11
CPCC12Q1/6806C12Q1/6851C12Q2531/113C12Q2563/107C12Q2527/127C12Q2521/107C12Q2545/113C12Q2545/101C12Q2527/125C12Q2563/143C12Q2563/149
Inventor王晓楠乔春晓马跃周科隆张亚楠
Owner3D BIOMEDICINE SCI & TECH CO LTD