Bifidobacterium lactis-containing fermented dairy product and application thereof
A technology for fermented dairy products and Bifidobacterium lactis is applied to the application field of fermented dairy products containing Bifidobacterium lactis, so as to achieve the effects of improving immunity and preventing and treating osteoporosis.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] Embodiment 1: Bifidobacterium lactis BL-99 and performance measurement thereof
[0045] The Bifidobacterium lactis BL-99 of the present invention is from Shanghai Jiaoda Only Co., Ltd., and is isolated from the intestinal tract of infants. The strain was preserved in China General Microorganism Culture Collection and Management Center CGMCC on April 26, 2018 (Address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences), taxonomic name: Bifidus lactis Bacillus (Bifidobacterium lactis); the deposit number is CGMCC No.15650.
[0046] 1. Taxonomic characteristics of Bifidobacterium lactis BL-99
[0047] Physical and chemical test results:
[0048]
[0049] 16S rRNA gene sequence sequencing results (SEQ ID No.1):
[0050] GCTCCCCCACAAGGGTCGGGCCACCGGCTTCGGGTGCTACCCACTTTCATGACTTGACGGGCGGTGTGTACAAGGCCCGGGAACGCATTCACCGCGGCGTTGCTGATCCGCGATTACTAGCGACTCCGCCTTCACGCAGTCGAGTTGCAGACTGCGATCCGAACTGAGACCGGTTTTCAGC...
Embodiment 2
[0170] Embodiment 2: the dairy product that contains the starter fermentation preparation of Bifidobacterium lactis BL-99
[0171] Preparation of Bifidobacterium lactis single-bacteria starter: refer to Figure 6 In the shown fermentation process, Bifidobacterium lactis BL-99 (that is, Bifidobacterium lactis with preservation number CGMCC No. 15650) is anaerobically cultured in TPY liquid medium. TPY liquid medium (g / L): hydrolyzed casein 10.0, soybean peptone 5.0, yeast powder 2.0, glucose 5.0, L-cysteine 0.5, dipotassium hydrogen phosphate 2.0, magnesium chloride 0.5, zinc sulfate 0.25, calcium chloride 0.15, ferric chloride 0.0001, Tween 80 1.0, pH 6.5±0.1. After primary, secondary and expanded culture, the fermentation broth was centrifuged at 4°C and 2500rpm for 10min to collect the bacteria. The collected bacteria were freeze-dried to obtain BL-99 active bacteria powder as a single-bacteria starter, and stored below -18°C.
[0172] Mix the above-mentioned single-bac...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap