Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Bifidobacterium lactis-containing fermented dairy product and application thereof

A technology for fermented dairy products and Bifidobacterium lactis is applied to the application field of fermented dairy products containing Bifidobacterium lactis, so as to achieve the effects of improving immunity and preventing and treating osteoporosis.

Active Publication Date: 2020-04-07
INNER MONGOLIA YILI INDUSTRIAL GROUP CO LTD
View PDF22 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] However, after investigation, there are few technical reports on the use of Bifidobacterium lactis for the treatment and / or prevention of osteoporosis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bifidobacterium lactis-containing fermented dairy product and application thereof
  • Bifidobacterium lactis-containing fermented dairy product and application thereof
  • Bifidobacterium lactis-containing fermented dairy product and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Embodiment 1: Bifidobacterium lactis BL-99 and performance measurement thereof

[0045] The Bifidobacterium lactis BL-99 of the present invention is from Shanghai Jiaoda Only Co., Ltd., and is isolated from the intestinal tract of infants. The strain was preserved in China General Microorganism Culture Collection and Management Center CGMCC on April 26, 2018 (Address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences), taxonomic name: Bifidus lactis Bacillus (Bifidobacterium lactis); the deposit number is CGMCC No.15650.

[0046] 1. Taxonomic characteristics of Bifidobacterium lactis BL-99

[0047] Physical and chemical test results:

[0048]

[0049] 16S rRNA gene sequence sequencing results (SEQ ID No.1):

[0050] GCTCCCCCACAAGGGTCGGGCCACCGGCTTCGGGTGCTACCCACTTTCATGACTTGACGGGCGGTGTGTACAAGGCCCGGGAACGCATTCACCGCGGCGTTGCTGATCCGCGATTACTAGCGACTCCGCCTTCACGCAGTCGAGTTGCAGACTGCGATCCGAACTGAGACCGGTTTTCAGC...

Embodiment 2

[0170] Embodiment 2: the dairy product that contains the starter fermentation preparation of Bifidobacterium lactis BL-99

[0171] Preparation of Bifidobacterium lactis single-bacteria starter: refer to Figure 6 In the shown fermentation process, Bifidobacterium lactis BL-99 (that is, Bifidobacterium lactis with preservation number CGMCC No. 15650) is anaerobically cultured in TPY liquid medium. TPY liquid medium (g / L): hydrolyzed casein 10.0, soybean peptone 5.0, yeast powder 2.0, glucose 5.0, L-cysteine ​​0.5, dipotassium hydrogen phosphate 2.0, magnesium chloride 0.5, zinc sulfate 0.25, calcium chloride 0.15, ferric chloride 0.0001, Tween 80 1.0, pH 6.5±0.1. After primary, secondary and expanded culture, the fermentation broth was centrifuged at 4°C and 2500rpm for 10min to collect the bacteria. The collected bacteria were freeze-dried to obtain BL-99 active bacteria powder as a single-bacteria starter, and stored below -18°C.

[0172] Mix the above-mentioned single-bac...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses a bifidobacterium lactis-containing fermented dairy product and an application thereof, and specifically provides the fermented dairy product. The fermented dairy product contains bifidobacterium lactis with a preservation number of CGMCC No.15650. The bifidobacterium lactis with the preservation number of CGMCC No.15650 can be present in the fermented dairy productas an active bacterium or inactivated form. The fermented dairy product has effects of preventing osteoporosis, adjusting balance of intestinal flora, etc.

Description

technical field [0001] The invention relates to a fermented milk product containing probiotics and its application, in particular to a fermented milk product containing Bifidobacterium lactis and its application in preventing osteoporosis and the like. Background technique [0002] Osteoporosis is a systemic metabolic skeletal disease characterized by decreased bone mass and destruction of bone microstructure. It is manifested by increased bone fragility, which can easily induce fractures. About 200 million people worldwide suffer from osteoporosis. As the incidence of hip fractures due to osteoporosis is increasing worldwide, the elderly population is largely affected by fracture risk. The total number of people with disabilities worldwide is 5.8 million per year. Fifty-one percent of this figure was due to fractures, mainly in Europe and the Americas. Consequently, osteoporotic fractures are considered to be an important cause of mortality and morbidity in developed co...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A23C9/123C12N1/20C12R1/01
CPCA23C9/1234C12N1/20A23V2400/531
Inventor 洪维鍊刘伟贤赵雯孙婷何剑刘红娟
Owner INNER MONGOLIA YILI INDUSTRIAL GROUP CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com