Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Calprotectin monoclonal antibody and application thereof

A monoclonal antibody and calprotectin technology, applied in the field of immunology, can solve the problems of cumbersome operation, time-consuming detection, inconvenient movement of detection equipment, etc., and achieve the effect of high detection sensitivity and good cross-linking effect

Pending Publication Date: 2020-04-14
苏州和锐生物科技有限公司
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the method used to detect calprotectin is mainly enzyme-linked immunosorbent assay (ELISA). Although the ELISA method has high sensitivity, the operation is cumbersome, the detection time is relatively long, and the detection equipment is large and not easy to move. Therefore, a Easy-to-operate and rapid assay method to detect calprotectin content

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Calprotectin monoclonal antibody and application thereof
  • Calprotectin monoclonal antibody and application thereof
  • Calprotectin monoclonal antibody and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] An embodiment of the present invention provides a calprotectin monoclonal antibody, which comprises VHCDR1-3 of the heavy chain variable region and VLCDR1-3 of the light chain variable region;

[0046] VHCDR1: GGATTCACTAGTAGCTATGCC

[0047] VHCDR2: ATTAGTAGTTATGGTAGCACC

[0048] VHCDR3: GCAACCTACAGGTACGAAGGGTTTGCTTAC

[0049] VLCDR1: ACTGGGGCTGTTACAACTAGTAACTAT

[0050] VLCDR2: GGTACCAAC

[0051] VLCDR3: GCTCTATGGTACAGCAACCTTTGGGTG.

[0052] Wherein, the amino acid sequences of VHCDR1, VHCDR2 and VHCDR3 are respectively shown in SEQ ID NOs: 1-3:

[0053] SEQ ID NO: 1Gly-Phe-Thr-Ser-Ser-Tyr-Ala

[0054]SEQ ID NO: 2Ile-Ser-Ser-Tyr-Gly-Ser-Thr

[0055] SEQ ID NO: 3Ala-Thr-Tyr-Arg-Tyr-Glu-Gly-Phe-Ala-Tyr.

[0056] Wherein, the amino acid sequences of VLCDR1, VLCDR2 and VLCDR3 are respectively shown in SEQ ID NOs: 4-6:

[0057] SEQ ID NO: 4Thr-Gly-Ala-Val-Thr-Thr-Ser-Asn-Tyr

[0058] SEQ ID NO: 5Gly-Thr-Asn

[0059] SEQ ID NO: 6Ala-Leu-Trp-Tyr-Ser-Asn-Leu-Trp-Val. ...

Embodiment 2

[0061] The present invention further discloses a preparation method of the above-mentioned mouse anti-human calprotectin monoclonal antibody, and the preparation method comprises the following steps:

[0062] The calprotectin monoclonal antibody is secreted by a hybridoma cell line; the preparation method of the hybridoma cell line comprises the following steps:

[0063] 1) Using natural calprotectin extracted from neutrophils as immune antigen;

[0064] 2) immunizing mice with the natural calprotectin prepared in 1);

[0065] 3) performing cell fusion of myeloma cell suspension and spleen B lymphocytes of immunized mice;

[0066] 4) culturing the fused cells, measuring the titer of the hybridomas, screening with natural calprotectin polymers, eliminating clones that react with protein monomers, and obtaining the hybridoma cell lines;

[0067] In order to overcome the problems of instability and degeneration of the hybridoma cell line, the hybridoma cell line is extracted fr...

Embodiment 3

[0095] The embodiment of the present invention discloses the application of the above-mentioned calprotectin monoclonal antibody in the immune detection tool of inflammatory bowel disease;

[0096] Immunological detection tools include inflammatory bowel disease detection kits.

[0097] (1) Calprotectin Immunoturbidimetric Quantitative Detection Kit

[0098] In this example, the calprotectin monoclonal antibody obtained in Example 1 is labeled with latex microspheres, the particle size is 200-300nm, and the microsphere concentration is 0.2-1.5% prepared with 3-morpholine propanesulfonic acid buffer solution, buffered The agent contains antibody stabilizers, preservatives and other components.

[0099] The preparation and operation of the calprotectin in vitro diagnostic kit are as follows:

[0100] 1. Preparation of R1 reagent:

[0101] 3-Morpholine propanesulfonic acid buffered saline solution: 0.2-1.0M, pH7.0-7.5 3-morpholine propanesulfonic acid buffer

[0102] 2. Prepa...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Particle sizeaaaaaaaaaa
Login to View More

Abstract

The invention discloses a calprotectin monoclonal antibody containing a VHCDR1-3 sequence of a heavy chain variable region and a VLCDR1-3 sequence of a light chain variable region, a preparation method and application thereof in immune detection of inflammatory bowel diseases. When a cutoff value is set as 150microg / g, the sensitivity for diagnosing inflammatory bowel diseases is 72%, and the negative predicted value is 90% or more. On the basis that a mouse monoclonal hybridoma cell strain is successfully obtained, sequencing is conducted, and an effective antibody is obtained, a qualitativeor quantitative detection kit prepared from the recombinant antibody has the advantages of stable performance, accurate quantification and the like, and can realize high-sensitivity and high-specificity rapid detection of calprotectin in a sample.

Description

technical field [0001] The invention relates to the field of immunology, in particular to a calprotectin monoclonal antibody and its application. Background technique [0002] Fecal calprotectin (faecal calprotectin, FC) is a calcium and zinc binding protein with a molecular weight of 36kDa, and it is the expression of the S100A8 / A9 binding protein gene. Its components have the highest proportion in the cytoplasm of neutrophils, accounting for 30% to 40%, and are markers of acute inflammatory cell activation. Among them, the quantitative detection of fecal calprotectin has become an important marker for intestinal organic diseases such as inflammatory bowel disease and intestinal cancer. [0003] Calprotectin is a heterotrimeric protein composed of two heavy chains (MRP14) with a molecular weight of 14kD and a light chain (MRP8) with a molecular weight of 8kD linked by covalent bonds. Each chain can bind two calcium ions. It has anti-protease activity in the presence of ca...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K16/18G01N33/68G01N33/558
CPCC07K16/18G01N33/6893G01N33/558C07K2317/565G01N2333/47G01N2800/065
Inventor 陈菲王莹
Owner 苏州和锐生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com